ID: 1191108198

View in Genome Browser
Species Human (GRCh38)
Location X:56785392-56785414
Sequence ATGGAAGCACAGATGAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191108198_1191108205 27 Left 1191108198 X:56785392-56785414 CCCATCTTCATCTGTGCTTCCAT No data
Right 1191108205 X:56785442-56785464 CACGCACACTCACAAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191108198 Original CRISPR ATGGAAGCACAGATGAAGAT GGG (reversed) Intergenic
No off target data available for this crispr