ID: 1191108560

View in Genome Browser
Species Human (GRCh38)
Location X:56787939-56787961
Sequence CCACTCGGCTGTCTTATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191108560_1191108569 27 Left 1191108560 X:56787939-56787961 CCTTGTATAAGACAGCCGAGTGG No data
Right 1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG No data
1191108560_1191108563 -6 Left 1191108560 X:56787939-56787961 CCTTGTATAAGACAGCCGAGTGG No data
Right 1191108563 X:56787956-56787978 GAGTGGCCAGCGCCTCGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191108560 Original CRISPR CCACTCGGCTGTCTTATACA AGG (reversed) Intergenic
No off target data available for this crispr