ID: 1191108562

View in Genome Browser
Species Human (GRCh38)
Location X:56787954-56787976
Sequence AGGACGAGGCGCTGGCCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191108562_1191108572 23 Left 1191108562 X:56787954-56787976 CCGAGTGGCCAGCGCCTCGTCCT No data
Right 1191108572 X:56788000-56788022 GTCCTCCTGTGGTTTCCCAGAGG No data
1191108562_1191108569 12 Left 1191108562 X:56787954-56787976 CCGAGTGGCCAGCGCCTCGTCCT No data
Right 1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191108562 Original CRISPR AGGACGAGGCGCTGGCCACT CGG (reversed) Intergenic
No off target data available for this crispr