ID: 1191108564

View in Genome Browser
Species Human (GRCh38)
Location X:56787962-56787984
Sequence GCAGCTCCAGGACGAGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191108564_1191108572 15 Left 1191108564 X:56787962-56787984 CCAGCGCCTCGTCCTGGAGCTGC No data
Right 1191108572 X:56788000-56788022 GTCCTCCTGTGGTTTCCCAGAGG No data
1191108564_1191108569 4 Left 1191108564 X:56787962-56787984 CCAGCGCCTCGTCCTGGAGCTGC No data
Right 1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191108564 Original CRISPR GCAGCTCCAGGACGAGGCGC TGG (reversed) Intergenic
No off target data available for this crispr