ID: 1191108569

View in Genome Browser
Species Human (GRCh38)
Location X:56787989-56788011
Sequence CTATGATCCCAGTCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191108565_1191108569 -2 Left 1191108565 X:56787968-56787990 CCTCGTCCTGGAGCTGCAGCCCT No data
Right 1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG No data
1191108566_1191108569 -8 Left 1191108566 X:56787974-56787996 CCTGGAGCTGCAGCCCTATGATC No data
Right 1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG No data
1191108564_1191108569 4 Left 1191108564 X:56787962-56787984 CCAGCGCCTCGTCCTGGAGCTGC No data
Right 1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG No data
1191108562_1191108569 12 Left 1191108562 X:56787954-56787976 CCGAGTGGCCAGCGCCTCGTCCT No data
Right 1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG No data
1191108560_1191108569 27 Left 1191108560 X:56787939-56787961 CCTTGTATAAGACAGCCGAGTGG No data
Right 1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191108569 Original CRISPR CTATGATCCCAGTCCTCCTG TGG Intergenic
No off target data available for this crispr