ID: 1191108615

View in Genome Browser
Species Human (GRCh38)
Location X:56788242-56788264
Sequence TCCCATGTGAATAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191108615_1191108620 16 Left 1191108615 X:56788242-56788264 CCTTCCTCTTTATTCACATGGGA No data
Right 1191108620 X:56788281-56788303 AGCTTAGAGAAGCAAGGTTATGG No data
1191108615_1191108621 26 Left 1191108615 X:56788242-56788264 CCTTCCTCTTTATTCACATGGGA No data
Right 1191108621 X:56788291-56788313 AGCAAGGTTATGGTTGTAGTTGG No data
1191108615_1191108618 10 Left 1191108615 X:56788242-56788264 CCTTCCTCTTTATTCACATGGGA No data
Right 1191108618 X:56788275-56788297 ACCATCAGCTTAGAGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191108615 Original CRISPR TCCCATGTGAATAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr