ID: 1191109394

View in Genome Browser
Species Human (GRCh38)
Location X:56793252-56793274
Sequence CTGTGATCCCAGTCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191109391_1191109394 -8 Left 1191109391 X:56793237-56793259 CCTGGGGTGGCAGCCCTGTGATC No data
Right 1191109394 X:56793252-56793274 CTGTGATCCCAGTCCTCCTGTGG No data
1191109384_1191109394 16 Left 1191109384 X:56793213-56793235 CCAGCTGAGTGGCCAGCGCCTTG No data
Right 1191109394 X:56793252-56793274 CTGTGATCCCAGTCCTCCTGTGG No data
1191109390_1191109394 -2 Left 1191109390 X:56793231-56793253 CCTTGTCCTGGGGTGGCAGCCCT No data
Right 1191109394 X:56793252-56793274 CTGTGATCCCAGTCCTCCTGTGG No data
1191109389_1191109394 4 Left 1191109389 X:56793225-56793247 CCAGCGCCTTGTCCTGGGGTGGC No data
Right 1191109394 X:56793252-56793274 CTGTGATCCCAGTCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191109394 Original CRISPR CTGTGATCCCAGTCCTCCTG TGG Intergenic
No off target data available for this crispr