ID: 1191110837

View in Genome Browser
Species Human (GRCh38)
Location X:56802337-56802359
Sequence CAGAGGGCCAAGGGTCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191110837_1191110846 5 Left 1191110837 X:56802337-56802359 CCCTTGGGACCCTTGGCCCTCTG No data
Right 1191110846 X:56802365-56802387 CCATGGGAATCTGTGTTGCGTGG No data
1191110837_1191110847 8 Left 1191110837 X:56802337-56802359 CCCTTGGGACCCTTGGCCCTCTG No data
Right 1191110847 X:56802368-56802390 TGGGAATCTGTGTTGCGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191110837 Original CRISPR CAGAGGGCCAAGGGTCCCAA GGG (reversed) Intergenic
No off target data available for this crispr