ID: 1191113270

View in Genome Browser
Species Human (GRCh38)
Location X:56825075-56825097
Sequence CCGAAACCCTTCAGGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191113270_1191113273 -3 Left 1191113270 X:56825075-56825097 CCTTCATTCCTGAAGGGTTTCGG No data
Right 1191113273 X:56825095-56825117 CGGCCATTTGTTGTTCTGCCTGG No data
1191113270_1191113276 3 Left 1191113270 X:56825075-56825097 CCTTCATTCCTGAAGGGTTTCGG No data
Right 1191113276 X:56825101-56825123 TTTGTTGTTCTGCCTGGATTGGG No data
1191113270_1191113275 2 Left 1191113270 X:56825075-56825097 CCTTCATTCCTGAAGGGTTTCGG No data
Right 1191113275 X:56825100-56825122 ATTTGTTGTTCTGCCTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191113270 Original CRISPR CCGAAACCCTTCAGGAATGA AGG (reversed) Intergenic