ID: 1191113275

View in Genome Browser
Species Human (GRCh38)
Location X:56825100-56825122
Sequence ATTTGTTGTTCTGCCTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191113269_1191113275 7 Left 1191113269 X:56825070-56825092 CCAAACCTTCATTCCTGAAGGGT 0: 163
1: 237
2: 228
3: 213
4: 287
Right 1191113275 X:56825100-56825122 ATTTGTTGTTCTGCCTGGATTGG No data
1191113265_1191113275 26 Left 1191113265 X:56825051-56825073 CCTTACCTGCTGGTGTGATCCAA No data
Right 1191113275 X:56825100-56825122 ATTTGTTGTTCTGCCTGGATTGG No data
1191113272_1191113275 -6 Left 1191113272 X:56825083-56825105 CCTGAAGGGTTTCGGCCATTTGT No data
Right 1191113275 X:56825100-56825122 ATTTGTTGTTCTGCCTGGATTGG No data
1191113270_1191113275 2 Left 1191113270 X:56825075-56825097 CCTTCATTCCTGAAGGGTTTCGG No data
Right 1191113275 X:56825100-56825122 ATTTGTTGTTCTGCCTGGATTGG No data
1191113266_1191113275 21 Left 1191113266 X:56825056-56825078 CCTGCTGGTGTGATCCAAACCTT No data
Right 1191113275 X:56825100-56825122 ATTTGTTGTTCTGCCTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191113275 Original CRISPR ATTTGTTGTTCTGCCTGGAT TGG Intergenic
No off target data available for this crispr