ID: 1191125144

View in Genome Browser
Species Human (GRCh38)
Location X:56946565-56946587
Sequence TTGCCTGTCTTTATTTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191125144_1191125146 0 Left 1191125144 X:56946565-56946587 CCATATCAAATAAAGACAGGCAA No data
Right 1191125146 X:56946588-56946610 CACCCCTGGATATGTTAGTAAGG No data
1191125144_1191125150 28 Left 1191125144 X:56946565-56946587 CCATATCAAATAAAGACAGGCAA No data
Right 1191125150 X:56946616-56946638 GATTTATTTATGCAACAATGAGG 0: 6
1: 6
2: 7
3: 26
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191125144 Original CRISPR TTGCCTGTCTTTATTTGATA TGG (reversed) Intergenic
No off target data available for this crispr