ID: 1191135059

View in Genome Browser
Species Human (GRCh38)
Location X:57055232-57055254
Sequence GGCATCATGATACCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191135059_1191135062 1 Left 1191135059 X:57055232-57055254 CCAGATTTTGGTATCATGATGCC No data
Right 1191135062 X:57055256-57055278 CTGGCCTCATAAAATGAGCTAGG 0: 63
1: 8728
2: 5176
3: 3688
4: 3985
1191135059_1191135063 2 Left 1191135059 X:57055232-57055254 CCAGATTTTGGTATCATGATGCC No data
Right 1191135063 X:57055257-57055279 TGGCCTCATAAAATGAGCTAGGG 0: 61
1: 8917
2: 4478
3: 2369
4: 2257
1191135059_1191135065 27 Left 1191135059 X:57055232-57055254 CCAGATTTTGGTATCATGATGCC No data
Right 1191135065 X:57055282-57055304 GATTCTCTTTTCCTATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191135059 Original CRISPR GGCATCATGATACCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr