ID: 1191147948

View in Genome Browser
Species Human (GRCh38)
Location X:57188983-57189005
Sequence CTGGGAGAATGGAATCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191147948_1191147955 12 Left 1191147948 X:57188983-57189005 CCAACTTGATTCCATTCTCCCAG No data
Right 1191147955 X:57189018-57189040 ACCCCAGTCAATTGTAGGTTTGG No data
1191147948_1191147954 7 Left 1191147948 X:57188983-57189005 CCAACTTGATTCCATTCTCCCAG No data
Right 1191147954 X:57189013-57189035 CAGGGACCCCAGTCAATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191147948 Original CRISPR CTGGGAGAATGGAATCAAGT TGG (reversed) Intergenic
No off target data available for this crispr