ID: 1191149974

View in Genome Browser
Species Human (GRCh38)
Location X:57209909-57209931
Sequence CAGCTGACACCCACCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191149974_1191149978 -9 Left 1191149974 X:57209909-57209931 CCTCCATGGGTGGGTGTCAGCTG No data
Right 1191149978 X:57209923-57209945 TGTCAGCTGGGTTAATTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191149974 Original CRISPR CAGCTGACACCCACCCATGG AGG (reversed) Intergenic
No off target data available for this crispr