ID: 1191154762

View in Genome Browser
Species Human (GRCh38)
Location X:57261307-57261329
Sequence CTTTGTTAGGGCAAGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191154754_1191154762 -3 Left 1191154754 X:57261287-57261309 CCAGATCTGTAATCCCAGCTCTT No data
Right 1191154762 X:57261307-57261329 CTTTGTTAGGGCAAGGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191154762 Original CRISPR CTTTGTTAGGGCAAGGCGGG TGG Intergenic
No off target data available for this crispr