ID: 1191154762 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:57261307-57261329 |
Sequence | CTTTGTTAGGGCAAGGCGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1191154754_1191154762 | -3 | Left | 1191154754 | X:57261287-57261309 | CCAGATCTGTAATCCCAGCTCTT | No data | ||
Right | 1191154762 | X:57261307-57261329 | CTTTGTTAGGGCAAGGCGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1191154762 | Original CRISPR | CTTTGTTAGGGCAAGGCGGG TGG | Intergenic | ||
No off target data available for this crispr |