ID: 1191155302

View in Genome Browser
Species Human (GRCh38)
Location X:57266808-57266830
Sequence CAGATGATGTGGAGCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191155295_1191155302 10 Left 1191155295 X:57266775-57266797 CCAGGAGACAAGCAAAGTGGTGG No data
Right 1191155302 X:57266808-57266830 CAGATGATGTGGAGCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191155302 Original CRISPR CAGATGATGTGGAGCCCAGG GGG Intergenic
No off target data available for this crispr