ID: 1191157405

View in Genome Browser
Species Human (GRCh38)
Location X:57288679-57288701
Sequence CTGATGTCCTTTAAGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 398}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191157403_1191157405 12 Left 1191157403 X:57288644-57288666 CCGGCCTTAAAAGCATTTCTTAA 0: 1
1: 0
2: 15
3: 106
4: 733
Right 1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG 0: 1
1: 0
2: 3
3: 49
4: 398
1191157401_1191157405 21 Left 1191157401 X:57288635-57288657 CCACTGCGCCCGGCCTTAAAAGC 0: 1
1: 8
2: 108
3: 954
4: 4835
Right 1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG 0: 1
1: 0
2: 3
3: 49
4: 398
1191157404_1191157405 8 Left 1191157404 X:57288648-57288670 CCTTAAAAGCATTTCTTAACTTT 0: 1
1: 0
2: 5
3: 52
4: 607
Right 1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG 0: 1
1: 0
2: 3
3: 49
4: 398
1191157402_1191157405 13 Left 1191157402 X:57288643-57288665 CCCGGCCTTAAAAGCATTTCTTA 0: 1
1: 0
2: 10
3: 125
4: 757
Right 1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG 0: 1
1: 0
2: 3
3: 49
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191157405 Original CRISPR CTGATGTCCTTTAAGAAAAA TGG Intronic
900777657 1:4596643-4596665 CTGATACCCTTCAAGAAGAAGGG - Intergenic
901363786 1:8727798-8727820 CTGCTGACCTTTAAGAATAGTGG - Intronic
902087717 1:13875995-13876017 CTGATGTCCTTATTTAAAAAGGG - Intergenic
903638526 1:24838548-24838570 GTTGTGTCCTTTAAGGAAAAAGG - Intronic
905751287 1:40466859-40466881 CTGATATACTTTAAGATAAAAGG + Intergenic
906857769 1:49326998-49327020 CTGATGACCTTAAAGATAGAAGG - Intronic
908365519 1:63419355-63419377 CAGCTAACCTTTAAGAAAAAAGG - Exonic
908591199 1:65636836-65636858 CTGATGTCCGTGAATAAACAGGG - Exonic
908825825 1:68131826-68131848 CTGGTGTCCTTTGAAAGAAAAGG + Intronic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
910533572 1:88269866-88269888 CTGGTGTTCTTTTAAAAAAATGG + Intergenic
910552342 1:88489884-88489906 CTGATGTCCTTGTAAAAGAAGGG + Intergenic
910921210 1:92349546-92349568 CTTATTTCCTTTAAGAATAAAGG - Intronic
911156034 1:94637724-94637746 CAGATGTCCTCAAAGAACAATGG - Intergenic
913126838 1:115798806-115798828 CTGTTTTCCTTTAGGAATAAAGG - Intergenic
913942524 1:125121116-125121138 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
914897457 1:151689634-151689656 CTCATGTCCTTTAACAAAACAGG - Intronic
914956308 1:152165729-152165751 ATCGTGTCCTTTAAGAATAAAGG + Intergenic
915661404 1:157408682-157408704 CTGATGTCCTTATAAAAAGAGGG - Intergenic
916268348 1:162915054-162915076 CAAATGTCCTTGAAGAAAGAAGG - Intergenic
916626639 1:166565249-166565271 CTGATGTCATTTAAGCAGGAAGG - Intergenic
917174659 1:172220142-172220164 ATGATGTCATTGAAGAGAAAGGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917982093 1:180276112-180276134 CTGATCTCATTTAAGAGAATGGG - Exonic
918497138 1:185153520-185153542 CTGGTGACCTTTAAGAAAACAGG + Intronic
918645659 1:186901685-186901707 CTGATGTCCATGTAGGAAAAAGG + Intronic
920978675 1:210810718-210810740 TTGATATCCTTTGAGAAAATAGG - Intronic
921104385 1:211961111-211961133 CTGATGTCCTGAAAGAGATAGGG + Intronic
921252943 1:213314200-213314222 CTGATGTCCTTTATAAGAAGAGG - Intergenic
921821832 1:219625666-219625688 CTTATGACATTTAAGAAAATGGG + Intergenic
922318977 1:224467973-224467995 CTGATTTTTTTAAAGAAAAAAGG - Intronic
922541589 1:226424333-226424355 CTGTTGTCCTTTTAGGAAAAGGG + Intergenic
923399142 1:233599557-233599579 GTGAAGTCATTTAAGAAAAAAGG + Intergenic
923743327 1:236676424-236676446 TTGGTGAACTTTAAGAAAAAAGG + Intergenic
923843314 1:237698593-237698615 CTCATATCCTTTATGAAATAAGG - Intronic
923865659 1:237936767-237936789 CAGAAGTCTTTTAATAAAAAAGG + Intergenic
924011018 1:239665397-239665419 CTGATAACCTTTAAGACCAATGG - Intronic
924080103 1:240387150-240387172 ATGATGTAGTTTAAGAAAAAAGG - Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1063633657 10:7759387-7759409 CTTAAATCCTTTATGAAAAAAGG + Intronic
1064304327 10:14151822-14151844 CTGCTGCCCTTTAAAAACAAAGG - Intronic
1064878702 10:20024874-20024896 ATCATGTCCTTTAAGCAACATGG - Intronic
1065427094 10:25616902-25616924 CCCATTTCATTTAAGAAAAAGGG - Intergenic
1066591749 10:37002490-37002512 CTGTTGTCCTTTAAACGAAATGG + Intergenic
1067723367 10:48747389-48747411 CTGATGTCTTTTATAAAATATGG + Intronic
1068205098 10:53840093-53840115 CTGATGCCCATAAAGAAAATGGG + Intronic
1069091806 10:64208343-64208365 CTGGTGTCCTTAAAAGAAAAGGG - Intergenic
1069206347 10:65692056-65692078 CTGATGAACTCTCAGAAAAATGG - Intergenic
1069269008 10:66500488-66500510 CTGATCTAGTTTAAGAAGAAAGG + Intronic
1069325040 10:67223187-67223209 TTGATGTCCTTTGGGAGAAATGG - Intronic
1069635283 10:69921301-69921323 CTGATGTCCTTTTTATAAAAGGG - Intronic
1070900744 10:80026932-80026954 CAGATGTCCTTTTAGAATCAAGG + Intergenic
1070901451 10:80033449-80033471 CAGATGTCCTTTTAGAATCAAGG + Intergenic
1070902484 10:80042697-80042719 CAGATGTCCTTTTAGAATCAAGG + Intergenic
1070945825 10:80390819-80390841 CAGCTTTCTTTTAAGAAAAACGG - Intergenic
1070995702 10:80778763-80778785 CTAAAGTCCTCTAACAAAAAGGG - Intergenic
1072179765 10:92970427-92970449 CTGAAGTCCTTTATATAAAATGG - Intronic
1072914460 10:99528996-99529018 CTGAATTGCTTTAAAAAAAATGG + Intergenic
1073939394 10:108677698-108677720 CTGATGTCCTTAAAAAAAAACGG + Intergenic
1074960100 10:118436822-118436844 CCAACATCCTTTAAGAAAAAGGG + Intergenic
1075010753 10:118868007-118868029 CTGATGTCCTTCAAGGAAGAAGG + Intergenic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1075898344 10:126017896-126017918 TTGAGGGCATTTAAGAAAAAGGG + Intronic
1078266132 11:9757510-9757532 TTAACTTCCTTTAAGAAAAAAGG - Intergenic
1079296518 11:19240223-19240245 TTAATATCCTTAAAGAAAAAAGG + Exonic
1079383928 11:19962207-19962229 CTGATGTCCTCTGAGCAAGAGGG - Intronic
1079472112 11:20788655-20788677 GTGGTGTCCTTTAAGCACAAAGG + Intronic
1079592695 11:22199533-22199555 AAGATGTCCTTTAATAAAATAGG - Intronic
1081051902 11:38351628-38351650 CTGTTGTGCTTTAACAAGAAAGG - Intergenic
1081238843 11:40679264-40679286 CTGTTTCCCTTTAAAAAAAAAGG - Intronic
1081432750 11:42994514-42994536 CTGATGACATTAAAGAATAATGG - Intergenic
1082116567 11:48335971-48335993 CTAATGTCCTTTTAAAAACATGG + Intergenic
1082210485 11:49495677-49495699 TTGATGTCCTTATAAAAAAAGGG - Intergenic
1082257226 11:50044339-50044361 CTAATGTCCTTTTAAAAACATGG - Intergenic
1082734091 11:56837468-56837490 CTGAGGTGGTTGAAGAAAAAGGG - Intergenic
1085499114 11:77002068-77002090 CTGGTGTCCTTTATCAGAAAAGG - Intronic
1085840381 11:80004884-80004906 CTGATGTCCTTAAAAAAAAGAGG - Intergenic
1085896543 11:80646747-80646769 CTGTTGTCCTTTAAAGGAAATGG - Intergenic
1086296106 11:85369750-85369772 GTGGTGTCCTTTAAGAGACAGGG - Intronic
1088412813 11:109554043-109554065 CTGATTTCTTTAAAGAAAACTGG - Intergenic
1088609755 11:111565805-111565827 CTGGTGTCCTCAAAAAAAAAAGG + Intergenic
1088775462 11:113078284-113078306 CTCGTGTCCTTAAAGAAAAGGGG - Intronic
1089200632 11:116722804-116722826 CCCCTGTCCTCTAAGAAAAAGGG + Intergenic
1089654709 11:119938747-119938769 CTGATTTCCTTTAACTCAAAGGG - Intergenic
1089884280 11:121804352-121804374 CTGTTCCCCTTTAAGAAAATAGG - Intergenic
1091416830 12:295217-295239 CTGGTGTCCTACAAGAAGAAAGG + Intronic
1093587439 12:20856869-20856891 CTCAAGTCCTTTAGGTAAAAAGG - Intronic
1093624918 12:21334122-21334144 ATAATTTCCTGTAAGAAAAATGG - Intronic
1093860485 12:24160346-24160368 CTGATGTACTAAAAGAAGAATGG + Intergenic
1093925702 12:24906285-24906307 GTGATGTTCACTAAGAAAAAAGG + Intronic
1094772863 12:33685638-33685660 CTGCTGTCCTTTAATCTAAAAGG - Intergenic
1095553204 12:43469819-43469841 TTGTTGTGCTTTAAGAGAAATGG + Intronic
1095600452 12:44007292-44007314 CTGATCTTCATAAAGAAAAAAGG - Intronic
1095774658 12:45999253-45999275 CTGATGTCCTTATAGGAAGAGGG + Intergenic
1096531445 12:52245142-52245164 CTGATGTTCTCTTAGAAAAGAGG + Intronic
1099462184 12:82937399-82937421 CTGATGTCCTTTTAAGAAGATGG - Intronic
1100216551 12:92455972-92455994 CTGATGTCCTTATAAGAAAAGGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1103033982 12:117641554-117641576 CTGATGTCCTTATAAAAAGAAGG - Intronic
1103690442 12:122768893-122768915 TTGATGTCATTCAGGAAAAATGG + Exonic
1105675016 13:22661770-22661792 ATGTTGTCTTTCAAGAAAAAGGG + Intergenic
1106724085 13:32466694-32466716 GTGACTTCCTTTAGGAAAAAAGG + Intronic
1107613522 13:42140659-42140681 CTGATGTACTTTTTGAAGAAGGG + Intronic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108645769 13:52426059-52426081 CTGATGGTCTATAATAAAAAAGG + Exonic
1108875651 13:55046204-55046226 CTGAAGTCTTTTATGAAATAAGG + Intergenic
1108922064 13:55688153-55688175 TTAACGTGCTTTAAGAAAAATGG + Intergenic
1109143944 13:58752790-58752812 CTGATATCCTTAAAAGAAAATGG + Intergenic
1110068118 13:71134717-71134739 CTGATGTCCTTACAGAAAGAAGG - Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111548637 13:89778845-89778867 CTCAAGTCCTTTATGTAAAATGG - Intergenic
1112599828 13:100843992-100844014 ATCCCGTCCTTTAAGAAAAAGGG - Intergenic
1113539660 13:111096323-111096345 CAGAAGACCTTTAAGAAACAGGG - Intergenic
1115676204 14:35677902-35677924 CTGACGCCCTAAAAGAAAAAAGG + Intronic
1116215801 14:42015922-42015944 CTGATGTCCTTTGATGGAAAAGG + Intergenic
1116623286 14:47233917-47233939 CTCAGGTCCTCTAAGAAAATAGG + Intronic
1118117350 14:62795553-62795575 CTGAAGTCCCTTACGTAAAATGG - Intronic
1118512704 14:66493073-66493095 CTCGTGTCCTTTTTGAAAAATGG - Intergenic
1118962078 14:70543035-70543057 GTGATTTCTTTTAATAAAAATGG + Intergenic
1118982654 14:70729238-70729260 GTGATGCCCTTGAAGTAAAATGG - Intronic
1120143067 14:80950075-80950097 CTGATGTCCTTGTAGGAAGAGGG + Intronic
1120211182 14:81635491-81635513 CTTATTTTTTTTAAGAAAAATGG - Intergenic
1121425153 14:93845414-93845436 CTGATGTCCCCTAAGCAAGAGGG + Intergenic
1123737931 15:23203195-23203217 CTTTTGGCCTTTAAGAACAAGGG + Intergenic
1124289140 15:28431864-28431886 CTTTTGGCCTTTAAGAACAAGGG + Intergenic
1124294082 15:28485446-28485468 CTTTTGGCCTTTAAGAACAAGGG - Intergenic
1125305357 15:38306177-38306199 ATGATTACCTTTGAGAAAAAAGG - Intronic
1126652184 15:50935708-50935730 CTGCGGACCTTTAAGAACAATGG + Intronic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1126921987 15:53537020-53537042 CTGTTTTTCATTAAGAAAAAAGG - Intronic
1127153656 15:56105839-56105861 CTCATGTTTTTAAAGAAAAAAGG + Intronic
1127247779 15:57196363-57196385 CTCAAGTCCTTTAAATAAAATGG - Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1128424647 15:67528886-67528908 ATGAAGTCCTTTAAGTATAATGG - Exonic
1130372021 15:83293101-83293123 CTACTATCCTTAAAGAAAAATGG - Intergenic
1130847535 15:87761336-87761358 CTGATGTCCAACAAGAAAATAGG + Intergenic
1131353522 15:91723313-91723335 TTGATATCCTTTAAAATAAATGG - Intergenic
1132066067 15:98732340-98732362 CAGATGTCCTCTAAGAATGAAGG + Intronic
1133330055 16:4967310-4967332 CTGGTGTCCTTATAAAAAAACGG - Intronic
1134329045 16:13233707-13233729 CTGATGTAAATTAAGAAAACAGG + Intronic
1134361336 16:13533667-13533689 GTGATATCCTTGAAGAAGAAGGG - Intergenic
1135199533 16:20425059-20425081 CTGATGTGCTTTAAAATAACAGG + Intronic
1135219161 16:20598549-20598571 CTGATGTGCTTTAAAATAACAGG - Intergenic
1136109333 16:28054815-28054837 CAGATGTCTTTAAAAAAAAATGG + Intronic
1136696025 16:32082960-32082982 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1136796519 16:33026214-33026236 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1138583342 16:57955675-57955697 CTGATGTCCTTTTTAAAGAACGG + Intronic
1138804425 16:60077629-60077651 CTGAGGTGCTGTTAGAAAAAAGG - Intergenic
1140754440 16:78055092-78055114 CTGAGGTCCTGAAAGAAAATAGG + Intronic
1140995652 16:80256922-80256944 CTGATGTCCTTATAAAAAAGAGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG + Intronic
1144051179 17:11498386-11498408 AAGATGTCCTTTAAGAGAGAAGG + Intronic
1144245918 17:13364468-13364490 CTTGCGTGCTTTAAGAAAAATGG - Intergenic
1144478038 17:15605747-15605769 CTGATGTTTTCCAAGAAAAAAGG - Intronic
1146932239 17:36785491-36785513 CTGATGCCCTTTGACAAGAATGG + Intergenic
1148822998 17:50371378-50371400 TTGATGTGCTTTGAGAAGAAAGG - Intronic
1149153903 17:53603284-53603306 TTGATGTTCTTAAACAAAAACGG - Intergenic
1149653369 17:58293268-58293290 CTGGTGTCATTTCAGAGAAATGG - Intergenic
1151134697 17:71934994-71935016 CCAATGTCCTTTCAGGAAAATGG + Intergenic
1152126668 17:78451214-78451236 CTCATGTTCTTTAAGCAAAGAGG + Intronic
1152173144 17:78767316-78767338 GAGATGTACTTTAAAAAAAATGG - Intronic
1153475230 18:5491857-5491879 CTTATGTCCTTTGAGAAATGTGG - Intronic
1153487576 18:5615837-5615859 GGGTTGTCCTTCAAGAAAAAAGG - Intronic
1153987498 18:10366642-10366664 CTGATGCCCTAAAACAAAAAAGG + Intergenic
1155135355 18:22986233-22986255 ATGATGTCCTTTAAGCCAAGTGG + Intronic
1155452908 18:25981581-25981603 ATGTTTTGCTTTAAGAAAAAGGG + Intergenic
1156844342 18:41646773-41646795 CTGCTGTCCTTCCAGAAAATCGG + Intergenic
1157316564 18:46594731-46594753 ATGATGTGCTTAAAGAAATACGG - Intronic
1157510185 18:48265864-48265886 ATGATGTCGTTTTAGCAAAAGGG - Intronic
1157569775 18:48704674-48704696 CTGATGTCCTTGTAAAAACAAGG - Intronic
1158598461 18:58836991-58837013 CTCAAGTCCTTTAAATAAAATGG + Intergenic
1158611283 18:58942913-58942935 CATATGTTCTCTAAGAAAAACGG - Intronic
1159802876 18:72922741-72922763 CTGATTTTTTATAAGAAAAATGG + Intergenic
1160345528 18:78128979-78129001 CTGCTGTCCTTTTAAAAAGAGGG + Intergenic
1160474333 18:79168580-79168602 CTGATGTCCTGTGAGACAGAAGG - Intronic
1160596647 18:79980067-79980089 CTGGTGTCCTTAGAGGAAAATGG + Intronic
1161979255 19:7622025-7622047 CTGATGTCCTTTATAAGAAGAGG + Intronic
1162686584 19:12390661-12390683 TTCATGTCCTTGAAGAAAACGGG + Exonic
1162690916 19:12430351-12430373 TTCATGTCCTTGAAGAAAACGGG + Exonic
1163673300 19:18641924-18641946 AAGATGTCTTTTAAGAAAGAGGG - Intronic
1165141402 19:33702408-33702430 GAAATGTCCTTTGAGAAAAATGG - Intronic
1165280977 19:34796909-34796931 CTGACGTCCTTTTAAAAACATGG + Intergenic
1166155695 19:40909606-40909628 TTTATGTCCTTAAAGCAAAAAGG + Intergenic
925240643 2:2323695-2323717 CTGAGTTCTTTTCAGAAAAATGG - Intronic
925648845 2:6067300-6067322 CTGATGTCCTTTCAGGACACAGG + Intergenic
925648849 2:6067329-6067351 CTGATGTCCTTTCAGGACACAGG + Intergenic
926131446 2:10305156-10305178 TTTATGTCCTACAAGAAAAAAGG + Intronic
927081356 2:19633990-19634012 GTGCTGTCCTTTAACAAGAAGGG - Intergenic
927272972 2:21233056-21233078 CTGATGACTTCTAAGAGAAAAGG - Intergenic
927375214 2:22405424-22405446 CTGCTGACCATTAAGGAAAAGGG + Intergenic
928161164 2:28926265-28926287 CTGACGGCAGTTAAGAAAAATGG - Intronic
930037388 2:47095291-47095313 CTGGTGTCCTTTATTAAAAGGGG + Intronic
931100898 2:58999853-58999875 CAAATGTCATTTAATAAAAAAGG - Intergenic
931666048 2:64609970-64609992 CTGGGGTACTTTAATAAAAATGG + Intergenic
931774246 2:65526468-65526490 CTGTTGTCCTTTGGGAACAATGG + Intergenic
931960066 2:67472607-67472629 CTAATGTTCTTTAATAAAAGTGG + Intergenic
932059848 2:68485259-68485281 CTGATGTCATTAAAGACAAAAGG - Intronic
933033585 2:77363521-77363543 CTTATGTCCTTTAAGGAATCAGG + Intronic
935930839 2:108123153-108123175 CAGATGTCCTTTATTAAATATGG - Intergenic
936727565 2:115339287-115339309 TTGATGTCATTAAAAAAAAATGG - Intronic
937898817 2:127000341-127000363 CTGACTTCCTCTAAGAAAGAAGG - Intergenic
938005120 2:127783074-127783096 CTCAAGTCCTTTAAATAAAATGG - Intronic
938247172 2:129786865-129786887 CTGAAATCCTTTTGGAAAAAAGG - Intergenic
938277477 2:130038675-130038697 TTGATGTCCTTTGAGAAATAAGG + Intergenic
938437906 2:131298705-131298727 TTGATGTCCTTTGAGAAATAAGG - Intronic
938865753 2:135418276-135418298 CTCATGTCCTTCATGTAAAATGG - Intronic
939418252 2:141929473-141929495 CTTCTGTCTTTTAAAAAAAATGG - Intronic
939563785 2:143762814-143762836 CTGATATGCTTCACGAAAAATGG - Intronic
940661734 2:156553779-156553801 TTGGTGTCTTTTAAGAATAAAGG + Intronic
941209522 2:162619858-162619880 CTTATGTCCTTTTAAAAATAAGG - Intronic
941249722 2:163147218-163147240 ATGATTTTCTTTAACAAAAATGG + Intergenic
941509509 2:166388136-166388158 ATGTTGTCATTTATGAAAAATGG + Intergenic
941573292 2:167198494-167198516 CTAATGTGCTTTAAGTGAAAAGG - Intronic
941585228 2:167350403-167350425 TTGTAGTCTTTTAAGAAAAATGG + Intergenic
941979979 2:171444729-171444751 TGGCTGTCCTTTAGGAAAAACGG + Intronic
942876200 2:180801835-180801857 CTGGTTTCCAATAAGAAAAAAGG + Intergenic
944295496 2:198057118-198057140 CTCATCTCCATTAAGAAAAGTGG - Intronic
944627643 2:201588634-201588656 CTGATGTGCTTCAAAAACAATGG + Intronic
946001057 2:216482771-216482793 CAGAAGTCCTTTGAGAAAGAAGG + Exonic
946479660 2:220041933-220041955 CAAATGTCCTTTAACAAATAGGG + Intergenic
947570530 2:231230663-231230685 CTCAAGTCCTTTATGTAAAATGG + Intronic
948371464 2:237492224-237492246 CTGATGAACTTCAAAAAAAAAGG + Intronic
1170117419 20:12875325-12875347 CTGATTTCCATAAACAAAAAAGG - Intergenic
1170326755 20:15164335-15164357 CTGAAGTCCCTTATAAAAAATGG - Intronic
1170383549 20:15789435-15789457 TTGCTGTCATATAAGAAAAATGG - Intronic
1171225852 20:23441517-23441539 CTGAAGTCTTTTATGTAAAATGG + Intronic
1172671742 20:36639243-36639265 CTGACGTCCTTTGAGGAAGAGGG + Intronic
1172935551 20:38617472-38617494 CTGAGGTCCATCGAGAAAAAGGG + Intronic
1173078301 20:39841930-39841952 CAGATGTGCTTGGAGAAAAAAGG + Intergenic
1173869727 20:46333705-46333727 CTGATGGGCCTTTAGAAAAACGG + Intergenic
1174117199 20:48234588-48234610 CTGAGGTCCTTTGGGTAAAATGG - Intergenic
1174976951 20:55346380-55346402 CTCAAGTCCTTTATGTAAAATGG + Intergenic
1176430404 21:6571844-6571866 CTGATGTCCTTTAAGGGGAAAGG - Intergenic
1176993203 21:15522561-15522583 ATGATGTCCCTTAAAAAAAGAGG - Intergenic
1177862130 21:26466618-26466640 CTTATATTCTTTAAGGAAAACGG - Exonic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1178024851 21:28454474-28454496 CTCATTCCCTTTAAGAAGAATGG - Intergenic
1178158259 21:29880355-29880377 CAGATGTGCATTAAGAAAAATGG + Intronic
1179705798 21:43179306-43179328 CTGATGTCCTTTAAGGGGAAAGG - Intergenic
1179914693 21:44468559-44468581 CTCATGTCATTTATTAAAAAGGG - Intergenic
1180648558 22:17359936-17359958 CTGTTGGCCTTAAAGGAAAAAGG + Intronic
1181429044 22:22866549-22866571 CTGATGTCATTCATGAAAATTGG + Intronic
1182274071 22:29173637-29173659 CTGGTTTGCTTTAAAAAAAACGG + Intergenic
1182811305 22:33119112-33119134 CTAATGTCCTTTTAAAAATATGG + Intergenic
1183312364 22:37117504-37117526 CTGATCTCCAATAAGAAAAATGG + Intergenic
1184051569 22:42009536-42009558 ATGATGTCCTTTTAGAAAACTGG - Intronic
1203324737 22_KI270738v1_random:3372-3394 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
951166388 3:19488593-19488615 CTGAGGTCATCCAAGAAAAAGGG - Intronic
951345629 3:21543957-21543979 GTGGGGTCCTTTAAGAAACAGGG - Intronic
951725644 3:25755306-25755328 CTGAAGTCCTTAATTAAAAAGGG + Intronic
951816199 3:26757714-26757736 CTGTTATCCTTTATCAAAAATGG + Intergenic
951945352 3:28129732-28129754 CTGATGTCTGTCAAGCAAAATGG + Intergenic
956047965 3:65216621-65216643 CTGAAGTCCCTTGAGGAAAAAGG + Intergenic
956147719 3:66208356-66208378 ATGATTTCCTTTAAAAAAAAAGG - Intronic
956574195 3:70733333-70733355 ATGAAGTCATTTAAGAAAAATGG - Intergenic
956906653 3:73772804-73772826 CTGATGTCTCTGAAGATAAAAGG + Intergenic
957468101 3:80621726-80621748 ATGATTTCCTTTAAAAAATAAGG - Intergenic
958458623 3:94365621-94365643 CAGATATCCTTTAAGAACACAGG + Intergenic
959382832 3:105662577-105662599 CTTATATCTTTTAAGAAAATTGG - Intronic
959882690 3:111463604-111463626 CTAATGACCTTTGAGAAAGATGG - Intronic
961902656 3:130228174-130228196 CTATTGTCCCCTAAGAAAAATGG - Intergenic
963640049 3:147849781-147849803 ATGATGTCTTTGAAGAAAACTGG + Intergenic
964020065 3:151999269-151999291 CAGATGTATTTAAAGAAAAAGGG + Intergenic
964116435 3:153140707-153140729 CAGATTTCTTTTAAGAAAAGTGG + Intergenic
964225952 3:154402202-154402224 CTGATGTCCTTAAAGCAAATGGG + Intronic
964333440 3:155629182-155629204 CTGATGTCATTCAGAAAAAATGG - Intronic
964493341 3:157260993-157261015 TTGTTGTCCTTTAAGAAGAAGGG - Exonic
964511971 3:157462811-157462833 TTGATCACCTTTAAGACAAAAGG - Intronic
965482661 3:169239203-169239225 TTGATTACCTTTAAGAAAAAAGG - Intronic
965863356 3:173173804-173173826 CTCAAGTACTTTAAGAAAACAGG - Intergenic
966759466 3:183404036-183404058 TTGATGTCTTTTAACATAAAAGG - Intronic
967474376 3:189899175-189899197 CGCATGTCCTTTTAGAAAATCGG - Intergenic
967575400 3:191084647-191084669 TTGATGTACTTTATGAAATACGG + Intergenic
969488027 4:7483013-7483035 CTGATGTCCTTATGAAAAAAAGG + Intronic
970053170 4:11939318-11939340 CTGATGTCCTTATAAGAAAAGGG + Intergenic
970292243 4:14585919-14585941 ATCATGTCCTTTAAGAGATATGG + Intergenic
970513460 4:16803427-16803449 TTTATATCATTTAAGAAAAATGG + Intronic
971511823 4:27435944-27435966 CATCTGTCCTTTGAGAAAAAGGG + Intergenic
972591925 4:40496077-40496099 CTGCTTTCCTCTGAGAAAAAAGG + Intronic
972730873 4:41793615-41793637 TTGATGACCTGTATGAAAAAAGG + Intergenic
973734189 4:53854172-53854194 CTCATGTCCCTTATGTAAAATGG - Intronic
974641562 4:64639456-64639478 CTGTTTTCCATTAAGAAAAAGGG + Intergenic
974908800 4:68089766-68089788 CTGATCTCCTTTAATAAAATAGG - Intronic
975032319 4:69636119-69636141 CTGATGTCCTTCAAGACATTTGG + Intronic
975148762 4:70998533-70998555 CTCAAGTCCTTTATGTAAAATGG - Intronic
976196562 4:82537707-82537729 CTGATGTCCTTATAAAAAAGAGG + Intronic
976350567 4:84055672-84055694 CTCATGTCCTTCAACAAAATGGG - Intergenic
976882581 4:89946902-89946924 CTGATCTCCATTAAAAAAAATGG + Intronic
977211683 4:94225364-94225386 CTGATGTCCTTATAAGAAAAGGG - Intronic
977465451 4:97378638-97378660 TTGTTGTCAGTTAAGAAAAAAGG - Intronic
978232437 4:106416345-106416367 CTGAGATCCTCCAAGAAAAATGG - Intergenic
978360640 4:107927917-107927939 CAGATGTCCTTCAACAAAAGAGG - Intergenic
978424320 4:108566371-108566393 CTGAAGTTCTTCAATAAAAAAGG + Intergenic
978723812 4:111946589-111946611 CTGATGTCACCTGAGAAAAAGGG + Intergenic
978854987 4:113384664-113384686 CTGAAGTTCTTTTACAAAAATGG - Intergenic
979023126 4:115528223-115528245 TTGATCTCCTTAAAGAAACATGG - Intergenic
980314034 4:131173386-131173408 ATTATGGCATTTAAGAAAAAAGG - Intergenic
980661285 4:135862334-135862356 AAGATTTCCTTTAAGTAAAATGG + Intergenic
980953924 4:139409223-139409245 CTGATGTCCTTAAACATGAAAGG - Intronic
981147296 4:141340021-141340043 CCAATGTCCTTAAAGAATAAAGG + Intergenic
982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG + Intergenic
982423722 4:155230313-155230335 CTGATTTTTTTAAAGAAAAAAGG - Intergenic
982689955 4:158537415-158537437 CTTATGTCCTTTGAGAAAACAGG + Intronic
984036975 4:174681458-174681480 CTTATGTCCTTATAGAAAGAGGG + Intronic
984115049 4:175669823-175669845 CTGCTGTCCTTATAAAAAAAGGG + Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984489896 4:180420005-180420027 TTGCTTTCCTTTAACAAAAATGG - Intergenic
984734062 4:183094474-183094496 CTGATCTCCTTGAAGAAACAAGG + Intergenic
984928708 4:184827721-184827743 CTGGTGTCCTTATAGAAAGAAGG - Intergenic
986315729 5:6585149-6585171 CTGGTGTCCCTACAGAAAAAGGG + Intergenic
987076532 5:14387475-14387497 CTGATGGCTTTTGTGAAAAAGGG + Exonic
987719203 5:21613049-21613071 CTCAAGTCTTTAAAGAAAAAAGG + Intergenic
987895073 5:23934066-23934088 CTGATGTCCTTATAGGAAAAAGG + Intergenic
988165934 5:27590178-27590200 TAGATGGCCTTTAAGAATAATGG + Intergenic
988227270 5:28428295-28428317 TTGATGACTTTCAAGAAAAAAGG - Intergenic
988282448 5:29167587-29167609 CTGATGTCCTTTTAAAATGAGGG + Intergenic
988878307 5:35472729-35472751 ATGAAGTCCTATAAGACAAATGG - Intergenic
990683508 5:58273035-58273057 CTGATCTTGTTTAAGAAGAAAGG - Intergenic
992855169 5:80852759-80852781 CTGAAGCCCTATAAGAACAAGGG - Intronic
993366956 5:87046014-87046036 TGGATGTCCTTTAAAAAATATGG + Intergenic
993488236 5:88513701-88513723 AAGATGGCCTTTAAAAAAAAAGG - Intergenic
993942416 5:94075866-94075888 GTGATGTGCTATAAGAGAAAGGG + Intronic
994686897 5:102967089-102967111 CTGATGTACTTTCAGGAATATGG - Intronic
996091082 5:119352646-119352668 CAGATGTCTGTTAAGAAAAGGGG - Intronic
996186179 5:120477974-120477996 CTGATGATTATTAAGAAAAAAGG - Intronic
996737764 5:126773547-126773569 GTGATTTCCTTCAAGGAAAATGG - Intergenic
996819640 5:127612297-127612319 CTGATGTTCCTTAAGAAAAGGGG - Intergenic
998007950 5:138669831-138669853 ATGGTGTCCTTTGAGAACAAAGG - Intronic
999073014 5:148767736-148767758 CAGATGTGCTTTAAGGAAAGAGG + Intergenic
999685870 5:154102471-154102493 CTGATGTCCTCTGAGAGAGAAGG + Intronic
1000204425 5:159045089-159045111 AAGTAGTCCTTTAAGAAAAAAGG + Intronic
1000753133 5:165121985-165122007 CTGCTTTCCTTTAAAAACAAAGG - Intergenic
1000851494 5:166345798-166345820 CCAAAGTCCTTTAGGAAAAAAGG + Intergenic
1001218332 5:169876539-169876561 CTGATGGCCTGGAAGAACAAGGG + Intronic
1001312612 5:170622311-170622333 CTGATGTCCTTATAAAAAGAAGG + Intronic
1003192829 6:3889325-3889347 GTAATGTCCTTTAAGTAAACTGG + Intergenic
1003918024 6:10805873-10805895 CTGATGTCCTTATAAAAAGAAGG - Intronic
1004911672 6:20291709-20291731 CTGATGTTCTTTAAACATAAGGG - Intergenic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1007623369 6:43228515-43228537 CTGATGTCTTCACAGAAAAAGGG + Intronic
1007635210 6:43295785-43295807 CTGATGTCATTGAAGAATGATGG - Intronic
1007729075 6:43934934-43934956 CTGCTTTCCTTTAAGAATAGGGG - Intergenic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008876571 6:56336115-56336137 CTGATGTACTTTGAGAAATCTGG - Intronic
1009749392 6:67863863-67863885 CTGATGTCAAATAAGAAAAATGG - Intergenic
1009850867 6:69196550-69196572 CTGGTGTCCTTATAGAAAAAAGG - Intronic
1011590276 6:88964770-88964792 CTGATGGCCTTAAAGGAAACTGG - Intergenic
1012197092 6:96356731-96356753 CTGTTGTCCTCCAAGAAATACGG - Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1013577982 6:111504043-111504065 CAGATGTCCTTAGAGAACAAAGG - Intergenic
1014030055 6:116690789-116690811 CTCAGGTCCTTTATGTAAAATGG + Intronic
1014304239 6:119720488-119720510 CTTATGTATGTTAAGAAAAATGG - Intergenic
1014320228 6:119918800-119918822 CTGAAATCCTTTAACAAACAAGG + Intergenic
1014341593 6:120214956-120214978 GTGATGACCTTAAAGATAAATGG + Intergenic
1014492875 6:122083272-122083294 GTGATATACTTTAAGAAACAAGG + Intergenic
1014857336 6:126417814-126417836 TTGATGACTTTTAAGCAAAATGG - Intergenic
1015155328 6:130088580-130088602 CAGATGACATTGAAGAAAAATGG + Intronic
1018390007 6:163335087-163335109 CTGGTGTCCTTATAGAAAGAAGG + Intergenic
1019262692 7:90545-90567 CTGTTCTCCTTTCAGAGAAAAGG + Intergenic
1020549291 7:9580358-9580380 CTTATATCCTATAACAAAAATGG + Intergenic
1020975034 7:14995508-14995530 GTGATAACCTTAAAGAAAAAGGG - Intergenic
1021077019 7:16317531-16317553 CTAATGTCCATTTAGAAAAAGGG + Intronic
1021167813 7:17362017-17362039 ATGATGGCCTTGAAGATAAAGGG + Intergenic
1022959285 7:35410967-35410989 TTGATGTCCTTTCAGAAAAGTGG + Intergenic
1023525228 7:41095518-41095540 CTGATTTCAGTTAAAAAAAAAGG + Intergenic
1023590072 7:41772170-41772192 CTGATGCTGTTAAAGAAAAAAGG + Intergenic
1023633884 7:42189641-42189663 CTGATGGCTTTGAAGAATAAAGG + Intronic
1024430674 7:49284794-49284816 CTTATGTTTTCTAAGAAAAAGGG - Intergenic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024535011 7:50423194-50423216 CTGGTGTCCTTATAGGAAAAGGG + Intergenic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1024878540 7:54056539-54056561 CTGTTTTCCTTTGAGAAAAATGG - Intergenic
1025062896 7:55826490-55826512 AAGCTGTCCTTTAAGAATAAAGG + Intronic
1025320628 7:58089581-58089603 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
1025760852 7:64389876-64389898 CTGATCTCCTATGAGAACAATGG - Intergenic
1026133080 7:67636448-67636470 GTGATTTCCTTTCAGAAAGACGG + Intergenic
1027737063 7:81945898-81945920 CTGAGGTCTTTAAAGAAACATGG + Intergenic
1028417209 7:90594150-90594172 CTGATCTCATTTAAGAAAATTGG + Intronic
1029656822 7:101931203-101931225 GTGATGCCTTTTAAGAAGAAAGG - Intronic
1030195828 7:106852599-106852621 CTGGTATCCTCTAAGAAAACAGG - Intergenic
1031318138 7:120283308-120283330 CTGATTTCATTTAAGATGAAAGG + Intronic
1031478352 7:122249266-122249288 CTGATGTCCTTTTAAAAAGAGGG + Intergenic
1034004984 7:147461422-147461444 CTGATTGCCCTTCAGAAAAATGG - Intronic
1034407497 7:150914919-150914941 CAGATGTCCTATTAGAAAAGGGG - Intergenic
1034700356 7:153090080-153090102 CTGGTGTCCTTTCATAAGAATGG - Intergenic
1035086034 7:156258713-156258735 CTGGTGTCCTTTTATAAAGAGGG - Intergenic
1035426999 7:158784715-158784737 TTGATGTGCTTTAAGCAAATGGG - Intronic
1035951423 8:4025855-4025877 GTGATGTTCTTTAAAGAAAAAGG - Intronic
1036279499 8:7387972-7387994 CTGAAGTCCTTGATGTAAAATGG - Intergenic
1036342020 8:7923905-7923927 CTGAAGTCCTTGATGTAAAATGG + Intergenic
1037272899 8:17149258-17149280 ATGATGACATTTAACAAAAAAGG - Intergenic
1038049878 8:23798532-23798554 CTGATGTCATTCAAGAAAGCAGG - Intergenic
1038414039 8:27380258-27380280 CTGCTATCCTTTCAGAAGAAAGG - Intronic
1039416062 8:37394909-37394931 CTGATCTATTTTAAGAAAAAAGG - Intergenic
1040566758 8:48574233-48574255 GAGATGTCTTTGAAGAAAAAAGG + Intergenic
1041119522 8:54571874-54571896 CTGGTGTCCTTACAAAAAAAGGG - Intergenic
1041475151 8:58256812-58256834 TTGGTGTCTTTTAAGACAAAAGG + Intergenic
1042260035 8:66849307-66849329 GTGATGTCCTTTAATACAAAAGG - Intronic
1042451556 8:68953308-68953330 CTGATTTCCTTTAAGATCAATGG + Intergenic
1042760752 8:72269202-72269224 CTGATGTCCTTTCAGAAACATGG - Intergenic
1043482908 8:80670790-80670812 CTCATATCCTTCAAGAGAAATGG + Intronic
1043564779 8:81535713-81535735 CAGATCTCCTTTGAGGAAAATGG + Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044391245 8:91654518-91654540 CGGGTGTCCTCTGAGAAAAAAGG - Intergenic
1045767000 8:105684250-105684272 CTCAAGTCCTTTGTGAAAAAAGG - Intronic
1045967781 8:108045457-108045479 CTAATGTATTTTAATAAAAATGG - Intronic
1046403098 8:113733371-113733393 ATGATACTCTTTAAGAAAAATGG - Intergenic
1046648632 8:116812747-116812769 CTGATTTCCTTTTAGACAACTGG - Intronic
1046750492 8:117921600-117921622 CTGATGTCCATACAGATAAAAGG + Intronic
1046765961 8:118070197-118070219 ATGATGTCCTTTAAGAATCTTGG - Intronic
1047028099 8:120846672-120846694 CTGATTTACCTTAAAAAAAAAGG + Intergenic
1047182172 8:122599426-122599448 CTGATCTCCTCTGAGCAAAAAGG + Intergenic
1047381379 8:124367116-124367138 CTTTTGTCCAATAAGAAAAAGGG - Intronic
1048490792 8:134891759-134891781 CTGTTTTCCTTTAAGTAAAAAGG - Intergenic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1050409012 9:5341738-5341760 TTCATGTCCTTTAAACAAAAAGG + Intergenic
1051782855 9:20709358-20709380 CTGGTTTCCTTTTAGTAAAATGG + Intronic
1052104912 9:24501663-24501685 CTGATTTCCTGAAAAAAAAATGG + Intergenic
1055188126 9:73481453-73481475 ATGATCACCTTGAAGAAAAAAGG - Intergenic
1055396895 9:75885386-75885408 CTAATGTGATTCAAGAAAAAGGG - Intergenic
1056142376 9:83695580-83695602 GTTATATCCTTTAAGAAAACTGG + Intronic
1056182230 9:84096397-84096419 CTGCTGTCCATTAAGAAGTAAGG + Intergenic
1058354493 9:104067094-104067116 CTGAGGACTTTGAAGAAAAATGG - Intergenic
1059672472 9:116504440-116504462 TCAATGTCCTTTAAGTAAAATGG - Intronic
1060131905 9:121109088-121109110 CTCAAGTCCTTTATGTAAAATGG + Intronic
1060523675 9:124308676-124308698 CCGATGGCCTTTCAGAAAACTGG - Intronic
1060717934 9:125951560-125951582 CTGATTTGTTTTAAGAAAAGGGG + Intronic
1187239183 X:17496924-17496946 CTGATGCCCTTAAACTAAAATGG + Intronic
1188303978 X:28539764-28539786 CTGATGTCCTTAAAAGAAGAGGG + Intergenic
1190041488 X:47075965-47075987 CTAATGTCCTTTATAATAAAAGG - Intergenic
1190412931 X:50154854-50154876 CTCATGTCCCATAGGAAAAAAGG - Intergenic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191595758 X:62942554-62942576 ATGAAGCCCTTTAAGGAAAAGGG - Intergenic
1193748135 X:85309023-85309045 CTTATTTCTTTAAAGAAAAATGG + Intronic
1194087611 X:89548194-89548216 CTGATCTTCTCTGAGAAAAAGGG - Intergenic
1194445768 X:93986067-93986089 TTGATGTCATTCCAGAAAAAAGG - Intergenic
1194503529 X:94705910-94705932 GTGAAGCCCTTTAAGAAACAGGG - Intergenic
1195006536 X:100690839-100690861 CTGCTGTCCCTTAAGAATGAGGG - Intronic
1195779682 X:108448072-108448094 CTGCTGGCCTTTAACCAAAAGGG + Intronic
1196103155 X:111868596-111868618 CTGATTTCTTTTAGGAAACATGG - Intronic
1196475313 X:116077866-116077888 CTTAAGTCCTTTATAAAAAACGG - Intergenic
1197012451 X:121582772-121582794 TTGAATTTCTTTAAGAAAAAGGG + Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1198806187 X:140497654-140497676 CTGTTGACCTTTCAGAAAAGAGG - Intergenic
1198920863 X:141724930-141724952 CTGATGTCCTTTGGGAGAAATGG - Intergenic
1200440254 Y:3204064-3204086 CTGATCTTCTCTGAGAAAAAGGG - Intergenic
1200945620 Y:8833049-8833071 CTGATGTCCTTTGGAATAAATGG - Intergenic