ID: 1191158940

View in Genome Browser
Species Human (GRCh38)
Location X:57306249-57306271
Sequence ACTCTAAGTGTTACACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191158940_1191158942 0 Left 1191158940 X:57306249-57306271 CCAGAATGTGTAACACTTAGAGT 0: 1
1: 0
2: 1
3: 12
4: 203
Right 1191158942 X:57306272-57306294 GCTGGCCTTTACTCTACAAATGG 0: 1
1: 0
2: 1
3: 3
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191158940 Original CRISPR ACTCTAAGTGTTACACATTC TGG (reversed) Intronic
902031339 1:13424793-13424815 ACTCATCCTGTTACACATTCTGG - Intergenic
906578183 1:46909918-46909940 ACTCTAAGCATTACATATTAGGG - Intergenic
910497681 1:87851087-87851109 ACTCAAAGTGTTACACAATCTGG - Intergenic
910928311 1:92418486-92418508 ACTCTTAGTGGTATATATTCCGG + Intergenic
916436752 1:164784632-164784654 ACACAAAGTTTTACACATTGTGG + Intronic
917075522 1:171200526-171200548 ATCCTAAGTCTTACACTTTCAGG + Intronic
923399111 1:233598921-233598943 ATTCTAAGAGTTGCTCATTCAGG + Intergenic
1063203962 10:3812757-3812779 ACTCAAAGTGTTTCAGATTTTGG - Intergenic
1063784602 10:9366374-9366396 ATTCTAAGTGCTAAGCATTCAGG - Intergenic
1064524292 10:16237018-16237040 AGTGTAAGTGTTAAGCATTCAGG - Intergenic
1065698399 10:28401518-28401540 ACTCTAAGCGACACAGATTCTGG - Intergenic
1068410826 10:56652059-56652081 ACTCTAATTGATACACAGTTTGG - Intergenic
1074227073 10:111494887-111494909 ACTCTAAGTGTTTCCCTGTCTGG + Intergenic
1076066746 10:127454386-127454408 AGTCTAAGTGATACACAGTATGG - Intergenic
1078077456 11:8174775-8174797 ACTCATAATGTTAAACATTCTGG - Intergenic
1079634545 11:22719518-22719540 ACTCTTAGTGTTAAACAGTCTGG + Intronic
1080370835 11:31640679-31640701 ATTCTAAGTGTTACATTTTGTGG - Intronic
1087636663 11:100709774-100709796 ACTCAAAATGTAACCCATTCTGG - Intronic
1088946489 11:114518318-114518340 GCTCTAAGTGTTACACCTTTAGG + Intergenic
1089546737 11:119232741-119232763 CTTCTATGTGTTACCCATTCAGG - Intronic
1089990337 11:122853435-122853457 ACACTGAGTAATACACATTCTGG + Intronic
1090286187 11:125501514-125501536 ACTCTAGGTGTGATACATTCTGG - Intergenic
1091833684 12:3569028-3569050 ACTCTGATGGTTACACATGCTGG - Intronic
1096097485 12:48945691-48945713 AGTCTCAGTGTTACACAGGCTGG - Intronic
1096726544 12:53567991-53568013 ACATTAAGTGTTACAATTTCTGG + Intronic
1097929227 12:65166256-65166278 ACTTTAAGTGTTAGCCAGTCTGG + Intergenic
1097933382 12:65215767-65215789 ACTCTAAATATTTCACTTTCTGG - Intronic
1099490146 12:83278889-83278911 GCCCTAAATGTTACACATTCAGG - Intergenic
1100071696 12:90728307-90728329 AATCTAAGTGTCATTCATTCTGG + Intergenic
1100878608 12:98991614-98991636 ATTCTAAGTGCTACACAATCTGG + Intronic
1106212161 13:27659659-27659681 GCTCTAACAGTAACACATTCAGG - Intronic
1106796641 13:33213263-33213285 ATTCTAAGAGTTATACACTCTGG + Intronic
1108995206 13:56722839-56722861 ACTCTTGGTGTTTTACATTCTGG - Intergenic
1110960722 13:81621239-81621261 ACTTTAAGAATTCCACATTCAGG - Intergenic
1111229384 13:85322648-85322670 AATCTGAGTATTACAAATTCAGG + Intergenic
1116027882 14:39536828-39536850 CCTCTGAGTGTTACACATCAGGG - Intergenic
1120415870 14:84217229-84217251 ACTCCAAGTATGACTCATTCTGG - Intergenic
1122098716 14:99390221-99390243 ACTCTAAAAGTTACACTTTTTGG - Intergenic
1123374668 15:19563781-19563803 ACTCATAGAGTTGCACATTCCGG + Intergenic
1123678389 15:22736489-22736511 ACTCAAAGTGTTACATCTGCTGG + Intergenic
1124330581 15:28810758-28810780 ACTCAAAGTGTTACATCTGCTGG + Intergenic
1138964277 16:62065303-62065325 ACTCTAAATGTCACAAAATCTGG + Intergenic
1203143721 16_KI270728v1_random:1785803-1785825 ACTCTCTGTGACACACATTCTGG + Intergenic
1144068828 17:11648615-11648637 GCCCTATGTGTTACACATTAAGG - Intronic
1150504734 17:65687089-65687111 ACAATAAATGTTACACATACTGG - Intronic
1153733621 18:8042054-8042076 AATCTCTGTGTTAGACATTCAGG + Intronic
1160282346 18:77503207-77503229 ACTAAAAGTGTTACACACACAGG + Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
929986230 2:46735537-46735559 ACTCTAATTATTTCACATTTAGG + Intronic
931857688 2:66320326-66320348 ACTCTAAATGTTTCAGATTTAGG - Intergenic
940847547 2:158658208-158658230 ACTGTGATTGTTCCACATTCTGG + Exonic
941980163 2:171446592-171446614 AATCTAAGTGATAAACATTCAGG + Intronic
943516182 2:188890217-188890239 ACTCTAAGGGCTACACTTTCTGG - Intergenic
943861439 2:192869202-192869224 AGTCTAAATGTTACAGATACTGG + Intergenic
944305168 2:198170736-198170758 ACTCTCAGTGTTGAATATTCAGG + Intronic
946721144 2:222609647-222609669 ACTCTAAATCAGACACATTCAGG - Intronic
1174729037 20:52896363-52896385 ATTCTAAGTGTTAGATTTTCTGG + Intergenic
1174797386 20:53533594-53533616 GCACTAAGTCTTGCACATTCAGG - Intergenic
1176371401 21:6063999-6064021 ACTCTGTGTGTTGTACATTCTGG + Intergenic
1179614667 21:42574581-42574603 ACTCAAAAAGTTACAAATTCTGG + Intronic
1179752118 21:43474540-43474562 ACTCTGTGTGTTGTACATTCTGG - Intergenic
1184206712 22:43009078-43009100 CCTCTACGAGTGACACATTCTGG + Intronic
952489018 3:33847936-33847958 ACTCAAAGTGTTACATCTGCTGG + Intronic
955458869 3:59157523-59157545 CCTCTTAGTGGTGCACATTCTGG + Intergenic
955682681 3:61518617-61518639 ACTCCAAGGGTTACAAATTATGG - Intergenic
956202140 3:66717691-66717713 ACTCCAAGTCTCACATATTCTGG + Intergenic
961063784 3:123856671-123856693 TCTCAAAGTGTTACACAGGCTGG + Intronic
964261751 3:154847419-154847441 ACTTTATGTTTTACATATTCTGG - Intergenic
965122728 3:164583984-164584006 GCTCTAAATGTCAAACATTCAGG + Intergenic
966884772 3:184370990-184371012 ACTCTAACTGTTACTCCTTAAGG + Intronic
970916906 4:21346553-21346575 AGTCTAAGTTTTCCACATTAAGG - Intronic
972292543 4:37703406-37703428 TTCCTAAGTGTTCCACATTCTGG + Intergenic
973111005 4:46397846-46397868 TCTCTAGGTGTTACAGATTTGGG - Intronic
973858825 4:55040854-55040876 ACTCTGAGAGTTAAAAATTCTGG + Intergenic
974609066 4:64191582-64191604 AATCTAAGTGTTCCACTTTTGGG + Intergenic
979200625 4:117973768-117973790 ATTGTAAGTGTTTCCCATTCTGG - Intergenic
980533838 4:134089436-134089458 ACTATTAGTGTTTTACATTCTGG + Intergenic
984969812 4:185178070-185178092 TCTCTAAATGTTTCTCATTCAGG - Intronic
988262486 5:28906490-28906512 AATCTAAGTGTAACAAAGTCTGG + Intergenic
990821502 5:59845634-59845656 ACATTAAATGTTACACATTATGG - Intronic
991164775 5:63552546-63552568 ACTCTTAATGTTGCACACTCTGG + Intergenic
992660532 5:78955984-78956006 ACTCTATGTTTTACAATTTCAGG - Intronic
993774777 5:91979064-91979086 ATTTTAAGAGTTACACATACAGG - Intergenic
995062985 5:107831584-107831606 ACTCTCAGTGCCTCACATTCAGG + Intergenic
995940030 5:117570527-117570549 ACTCTAAGCCTTGCAGATTCAGG - Intergenic
996562254 5:124843475-124843497 ACTATAAGTCTTTCACATTCTGG - Intergenic
996571329 5:124935395-124935417 ATCCTAAGTGTAACACTTTCTGG - Intergenic
998337980 5:141390135-141390157 AATCTATGTGTTGCACATACAGG + Exonic
1001742298 5:174063768-174063790 ACTTTAATTGTTACACGTTTAGG - Intronic
1009848019 6:69158503-69158525 ACTCTAATTGAAAGACATTCTGG + Intronic
1010232782 6:73550217-73550239 AATCTAAGTATGAGACATTCTGG - Intergenic
1012524879 6:100165428-100165450 ACTAAAAGTGTGACACATTTGGG - Intergenic
1014266878 6:119288731-119288753 AATCTAACTGTTCAACATTCTGG + Intronic
1015597928 6:134883672-134883694 ACTCTGCCTTTTACACATTCAGG - Intergenic
1016263060 6:142197165-142197187 ACTCTAACATTTATACATTCTGG - Intronic
1020419421 7:7984354-7984376 TCTCTAAGTATAACAGATTCAGG - Intronic
1020524971 7:9247762-9247784 TCTCTGAGTTTTATACATTCTGG - Intergenic
1020582428 7:10020727-10020749 GATCTAAGTGTCACAAATTCTGG - Intergenic
1022550188 7:31231185-31231207 ACTCAAAATGTTACATGTTCAGG + Intergenic
1023667214 7:42536266-42536288 ACTCTCACTTTTACACTTTCAGG - Intergenic
1023702315 7:42904966-42904988 ACTCTATGTGGGACACAGTCTGG + Intergenic
1023714246 7:43026966-43026988 ACTCTTTGTATTTCACATTCTGG - Intergenic
1027655172 7:80921136-80921158 GCTCAATCTGTTACACATTCAGG + Intronic
1027956928 7:84891441-84891463 ACTCAAAGAGTTTCAGATTCTGG - Intergenic
1030265821 7:107620931-107620953 TCTCTAAATATTACCCATTCTGG + Exonic
1032835894 7:135673249-135673271 ATTCTAAGTGTAGCACATTTGGG + Intronic
1033476156 7:141695258-141695280 ACTCTAAGTGAAAGACATACAGG + Intronic
1035949347 8:4001967-4001989 ATTCTAACTGTAACTCATTCCGG - Intronic
1043960654 8:86414510-86414532 ACTCAAAGGGTTACACAGCCTGG - Intronic
1045086539 8:98692931-98692953 CCTCTAAATGTTACACAATTTGG + Intronic
1050640731 9:7664737-7664759 ACACAAAGTTTTTCACATTCAGG + Intergenic
1050692926 9:8248880-8248902 ACTCTAATGGTTAGACATTAGGG - Intergenic
1051979884 9:23001055-23001077 AGTCTAAGGGTAACACAGTCTGG - Intergenic
1055079260 9:72251813-72251835 ACTCTCAGTCTTTCACACTCAGG - Exonic
1055543596 9:77342739-77342761 ACCAGAAGTGTTTCACATTCTGG - Intronic
1058165628 9:101615674-101615696 TCTCCAAGTGATACACATTCTGG + Intronic
1061100050 9:128485466-128485488 ACTCTAAGACGTACTCATTCAGG - Exonic
1185434030 X:27266-27288 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434056 X:27510-27532 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434134 X:28242-28264 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434158 X:28486-28508 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434215 X:29035-29057 ACTCTAAAGGTTGCACACTCTGG - Intergenic
1185434257 X:29462-29484 ACTCTAAAGGTTGCACAGTCCGG - Intergenic
1185434277 X:29645-29667 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434322 X:30072-30094 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434502 X:31900-31922 ACTCTAAAGGTTGCACATTCTGG - Intergenic
1185434535 X:32204-32226 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434575 X:32570-32592 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434840 X:35131-35153 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434866 X:35375-35397 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185434937 X:36046-36068 ACTCTAAAGGTTGCACAGTCCGG - Intergenic
1185434957 X:36229-36251 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185435001 X:36656-36678 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185435183 X:38484-38506 ACTCTAAAGGTTGCACATTCTGG - Intergenic
1185435215 X:38788-38810 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185435255 X:39154-39176 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185435605 X:42569-42591 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185435663 X:43118-43140 ACTCTAAAGGTTGCACACTCTGG - Intergenic
1185435705 X:43545-43567 ACTCTAAAGGTTGCACAGTCCGG - Intergenic
1185435725 X:43728-43750 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185435770 X:44155-44177 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185436071 X:96174-96196 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185436149 X:96967-96989 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185436168 X:97150-97172 ACTCTAAAGGTTGCACAGTCCGG + Intergenic
1185436211 X:97577-97599 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185436267 X:98126-98148 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185436321 X:98674-98696 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185436394 X:99467-99489 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185436460 X:100138-100160 ACTCTAAAGGTTGCACATTATGG + Intergenic
1185436498 X:100504-100526 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185436519 X:100687-100709 ACTCTAAAGGTTGCACAGTCCGG + Intergenic
1185436613 X:101602-101624 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185436639 X:101846-101868 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185436663 X:102090-102112 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185436729 X:102760-102782 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185436788 X:103309-103331 ACTCTAAAGGTTGCACAGTCCGG + Intergenic
1185436830 X:103736-103758 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185437006 X:105383-105405 ACTCTAAAGGTTTCACAGTCTGG + Intergenic
1185437129 X:106542-106564 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185437189 X:107152-107174 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185437213 X:107396-107418 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185437287 X:108128-108150 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185437316 X:108433-108455 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185437661 X:111726-111748 ACTCTAAAGGTTTCACAGTCTGG + Intergenic
1185437784 X:112885-112907 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185437844 X:113495-113517 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185437868 X:113739-113761 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185437942 X:114471-114493 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185437971 X:114776-114798 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185438161 X:116666-116688 ACTCTAAAGGTTGCACAGTCCGG + Intergenic
1185438255 X:117581-117603 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185438281 X:117825-117847 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185438383 X:118862-118884 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185438449 X:119532-119554 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185438508 X:120081-120103 ACTCTAAAGGTTGCACAGTCCGG + Intergenic
1185438550 X:120508-120530 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185438727 X:122155-122177 ACTCTAAAGGTTTCACAGTCTGG + Intergenic
1185438808 X:122887-122909 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185438868 X:123497-123519 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185438888 X:123680-123702 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185438962 X:124412-124434 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185438992 X:124717-124739 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185439169 X:126485-126507 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185439209 X:126851-126873 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185439241 X:127155-127177 ACTCTAAAGGTTGCACATTCTGG + Intergenic
1185439323 X:128007-128029 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185439397 X:128739-128761 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185439427 X:129044-129066 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185439604 X:130812-130834 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185439644 X:131178-131200 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185439688 X:131605-131627 ACTCTAAAGGTTGCACAGTCTGG + Intergenic
1185439786 X:132459-132481 ACTCTAAAGGTTTCACAGTCTGG + Intergenic
1185439923 X:133740-133762 ACTCTAAAGGTTGCACACTCTGG + Intergenic
1185443122 X:238296-238318 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443152 X:238601-238623 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443217 X:239272-239294 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443287 X:239943-239965 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443351 X:240553-240575 ACTCTAAAGGTTGCACACTCTGG - Intergenic
1185443460 X:241651-241673 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443577 X:242810-242832 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443623 X:243237-243259 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443649 X:243481-243503 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443747 X:244457-244479 ACTCTAAAGGTTGCACAGTCCGG - Intergenic
1185443769 X:244640-244662 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443819 X:245127-245149 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185443855 X:245493-245515 ACTCTAAAGGTTGCACACTCTGG - Intergenic
1185443910 X:246042-246064 ACTCTAAAGGTTGCACACTCTGG - Intergenic
1185443949 X:246469-246491 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185444000 X:246956-246978 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185444036 X:247322-247344 ACTCTAAAGGTTGCACACTCTGG - Intergenic
1185444080 X:247749-247771 ACTCTAAAGGTTGCACAGTCCGG - Intergenic
1185444099 X:247932-247954 ACTCTAAAGGTTGCACAGTCTGG - Intergenic
1185444186 X:248847-248869 ACTCTAAAGGTTGCACACTCTGG - Intergenic
1190254760 X:48754152-48754174 ACTCCTAGTGTTACACAGACTGG - Intergenic
1191158940 X:57306249-57306271 ACTCTAAGTGTTACACATTCTGG - Intronic
1193691778 X:84654947-84654969 ACAGTAAGTTTTGCACATTCAGG + Intergenic
1195935500 X:110121931-110121953 ACTCGAAGTGTTTCAGATTTTGG + Intronic