ID: 1191160877

View in Genome Browser
Species Human (GRCh38)
Location X:57328938-57328960
Sequence GGTCCTCCTGGACCACTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191160866_1191160877 28 Left 1191160866 X:57328887-57328909 CCCACTTTCTTCTCTGACTTTTG 0: 1
1: 1
2: 1
3: 73
4: 657
Right 1191160877 X:57328938-57328960 GGTCCTCCTGGACCACTAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 126
1191160865_1191160877 29 Left 1191160865 X:57328886-57328908 CCCCACTTTCTTCTCTGACTTTT 0: 1
1: 1
2: 4
3: 92
4: 951
Right 1191160877 X:57328938-57328960 GGTCCTCCTGGACCACTAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 126
1191160875_1191160877 -6 Left 1191160875 X:57328921-57328943 CCTTCTGGGAGGGCTGAGGTCCT 0: 1
1: 0
2: 2
3: 26
4: 221
Right 1191160877 X:57328938-57328960 GGTCCTCCTGGACCACTAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 126
1191160867_1191160877 27 Left 1191160867 X:57328888-57328910 CCACTTTCTTCTCTGACTTTTGA 0: 1
1: 0
2: 8
3: 81
4: 708
Right 1191160877 X:57328938-57328960 GGTCCTCCTGGACCACTAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191160877 Original CRISPR GGTCCTCCTGGACCACTAGA AGG Intronic
904161571 1:28525842-28525864 GGTTCTCGGGAACCACTAGAAGG + Intronic
904594564 1:31635308-31635330 GGTCCTCCTGGAGTTCCAGAGGG + Exonic
908300264 1:62755765-62755787 TGTCCTCCTAGACCACAAGGAGG - Intergenic
909895841 1:81067812-81067834 GTTCCTTCTAGACCTCTAGAAGG - Intergenic
911298812 1:96149333-96149355 TGTCCTCCTAGACCACAAGGAGG - Intergenic
913469345 1:119173728-119173750 TGTCCTCCTAGACCACAAGGAGG - Intergenic
915651296 1:157312938-157312960 GCTCCTACTGGATCACTGGATGG + Intergenic
916939359 1:169663434-169663456 TGTCCTCCTAGACCACAAGGAGG - Intronic
917445968 1:175106092-175106114 TGTCCTCCTAGACCACAAGGAGG + Intronic
918750314 1:188262226-188262248 TGTCCTCCTAGACCACAAGGAGG + Intergenic
920238917 1:204529455-204529477 GGTCCTCCTGGAGTTCCAGAGGG + Intronic
923802379 1:237222699-237222721 GGTACTACTGGACTACTAGTAGG - Intronic
924847314 1:247786488-247786510 GGTCCTCCAGTACAAGTAGAGGG - Intergenic
1063321868 10:5058813-5058835 TGTCCTCCTAGACCACAAGGAGG + Intronic
1064603713 10:17017341-17017363 TGTCCTCCTAGACCACAAGGAGG + Intronic
1065239182 10:23687853-23687875 GGTGCTCCTGGACCTCCAGAAGG - Intergenic
1066614719 10:37283127-37283149 TGTCCTCCTAGACCACAAGGAGG + Intronic
1067208332 10:44238491-44238513 GGTGCTCCTGGGCCAGTTGAAGG + Intergenic
1069137484 10:64783389-64783411 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1074377547 10:112951741-112951763 GGGCCTCCTGGGCCACGAGCGGG - Intronic
1075246094 10:120823303-120823325 GGGCCTCCTGGAGTTCTAGAGGG - Intergenic
1076530859 10:131143334-131143356 GGTCCTCCTCGACCCCTTGGAGG + Intronic
1078434456 11:11312927-11312949 GGTCTTTCTCCACCACTAGATGG - Intronic
1079731382 11:23940165-23940187 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1081033277 11:38112906-38112928 TGTCCTCCTAGACCACAAAAAGG - Intergenic
1084210836 11:67621445-67621467 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1091208918 11:133840459-133840481 GGTGCTCCTGGAACATAAGAAGG - Intergenic
1092472150 12:8789689-8789711 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1093580701 12:20781876-20781898 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1100069549 12:90695597-90695619 GCTTCTCCTGTAACACTAGAGGG + Intergenic
1104282144 12:127387946-127387968 GGCCCTCCAGGACCACAAAAGGG - Intergenic
1105762330 13:23526254-23526276 TGTCCTCCTGGACCACAAGGGGG - Intergenic
1105796510 13:23859503-23859525 TGTCCACCTGGACACCTAGAAGG - Intronic
1106162546 13:27214106-27214128 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1106409505 13:29501428-29501450 GGTCCTCCTGCAGCACTGGGAGG + Intronic
1109500900 13:63235289-63235311 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1112326468 13:98445497-98445519 CTGCCTCCTGGGCCACTAGAGGG + Intronic
1112518979 13:100079768-100079790 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1115285605 14:31710526-31710548 TGTCCTCCTAGACCACAAGGAGG + Intronic
1122884165 14:104703199-104703221 GGACGCCCTGGACCACTACAAGG + Exonic
1124368582 15:29090703-29090725 GGCTCTCATTGACCACTAGATGG - Intronic
1125589578 15:40845905-40845927 AGTCTTCCTGGACCACCAAAAGG - Intronic
1139489828 16:67280183-67280205 GGTCCTCCAAGACCACCAGCCGG + Exonic
1140298058 16:73727831-73727853 GTTTCTCCTTGACCACCAGAGGG - Intergenic
1140841320 16:78842040-78842062 GATCCTCCTGGTCCCCTTGAAGG - Intronic
1142596834 17:1033856-1033878 GGTCCTCCTGGAGCCCTGGAAGG - Intronic
1146416521 17:32638657-32638679 GGTGCTCATGGACCACTAATGGG - Intronic
1146528395 17:33586293-33586315 GGTCCCCCTGCCCCCCTAGATGG - Intronic
1150321198 17:64215915-64215937 AGTGATCCTGGATCACTAGAAGG + Intronic
1151567863 17:74909841-74909863 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1154374350 18:13796715-13796737 GGTCCTCCAGGGCCGGTAGAGGG + Intergenic
1157858057 18:51119093-51119115 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1163815051 19:19460125-19460147 GGTCCTTCTGGGCCACAACAAGG + Intronic
1164686338 19:30168955-30168977 GGTCTTCCTGAATGACTAGAAGG + Intergenic
1164915323 19:32047307-32047329 GATCCTCCTAGACGTCTAGAAGG - Intergenic
1164981350 19:32616804-32616826 GGGACTCCTGGGCCACGAGAGGG - Intronic
1168434124 19:56304000-56304022 GGTTCTCATAGACCACGAGAAGG + Intronic
925950058 2:8901381-8901403 TGTCCTCCTAGACCACAAGGAGG + Intronic
926554019 2:14335454-14335476 GGTCTGCCTGGACCACAGGAAGG + Intergenic
929330227 2:40673571-40673593 TTTCCTCCTGGACCACAAGGAGG - Intergenic
937982315 2:127622932-127622954 GGTCCTCCTGGACCTCCAGTGGG - Intronic
938146055 2:128835672-128835694 GGTCCTCCCGGAGAACCAGAGGG + Intergenic
941243274 2:163068250-163068272 GGTCCTCCAAGACCACAAGGAGG - Intergenic
943133602 2:183886919-183886941 TGTCCTCCTAGACCACAAGGAGG - Intergenic
944728820 2:202498236-202498258 TGTCCTCCTAGACCACAAGGAGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1169268982 20:4184930-4184952 AGCCCTCTTGGACCACAAGATGG - Intronic
1169688649 20:8305631-8305653 CTTTCTCTTGGACCACTAGAGGG - Intronic
1169907127 20:10615615-10615637 GGTCCTCCTGGATATCTAAATGG - Intronic
1170594294 20:17793710-17793732 GGTCCTCCTGGATCAGAAGTGGG + Intergenic
1172111323 20:32546957-32546979 AGTCCTCCTGGTCCTCCAGAGGG + Intronic
1173427317 20:42954400-42954422 TGTCCTCCTGGACCAGGGGAGGG - Intronic
1174576982 20:51543431-51543453 GGTCCTCCTTGACCACCCAAGGG - Intronic
1176181336 20:63751277-63751299 GGGGCCCCTGGACCACGAGATGG - Intronic
1179044475 21:37832296-37832318 GCTACTCCAGGCCCACTAGATGG - Intronic
1180995706 22:19964245-19964267 GGTCTTCCTCGACCACTGGAAGG + Exonic
1182944809 22:34312012-34312034 GGTCCACCTGGGCCAGTTGAGGG + Intergenic
1183080704 22:35454269-35454291 GGTCCTCCTGGAGCTCCTGATGG + Intergenic
1184623641 22:45703924-45703946 GATCCTCCTGGAACCCGAGATGG - Intronic
950169145 3:10824726-10824748 GGTCCTCTTGGTCCTCTTGATGG + Intronic
951436434 3:22670472-22670494 GGACTTCCTGGACCACCAGTGGG + Intergenic
951441609 3:22730015-22730037 ATTCCTCCTGGACCATTGGATGG + Intergenic
952452862 3:33448044-33448066 TGTCCTCCTGGACCACAAGGAGG - Intergenic
952862814 3:37828936-37828958 GGTCCTCCAGGAGTACTAGTAGG + Intergenic
953158316 3:40394993-40395015 GGTCTTCGTGGACCTCCAGAAGG + Intronic
954136374 3:48583931-48583953 GGTCCCCCTGGACCAGGTGAAGG - Exonic
958549373 3:95594084-95594106 TGTCCTCCTAGACCACAAGGAGG + Intergenic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
964064342 3:152561304-152561326 TGTCCTCCTAGACCACAAGGAGG - Intergenic
964832384 3:160898647-160898669 GGTTCACCTGGTCCCCTAGAAGG - Intronic
967662741 3:192133144-192133166 GGTTTTCCTGGATCTCTAGACGG - Intergenic
972302458 4:37797733-37797755 GGTTCTCCTTGACCTCTACATGG + Intergenic
972336510 4:38111692-38111714 GGGCCTCATGGACCCCTAAAAGG + Intronic
973045706 4:45532862-45532884 TGTCCTCCTAGACCACAAGGAGG - Intergenic
974839017 4:67280888-67280910 TGTCCTCCTAGACCACAAGGAGG + Intergenic
975047843 4:69826335-69826357 TGTCCTCCTAGACCACAAAAAGG - Intronic
975480531 4:74874938-74874960 GATCCTTCTTGACCACCAGATGG + Intergenic
982464401 4:155712501-155712523 GATCATCCTGGACCACAAGAAGG - Intronic
984648545 4:182244655-182244677 AGTGTTCCTGGACCACTGGAGGG - Intronic
992455030 5:76908912-76908934 TGTCCTCCTAGACCACAAGAAGG - Intronic
995706199 5:114991405-114991427 TGTCCTCCTAGACCACAAGGAGG - Intergenic
996767500 5:127049056-127049078 TGTCCTACAGGACTACTAGAAGG + Intronic
997193791 5:131963858-131963880 GGTCCTCATGGTCCATTAGCTGG + Intronic
997457903 5:134031084-134031106 GGTCATCCAGGACCACCTGAGGG - Intergenic
1001930983 5:175672829-175672851 GGGCCTCCTGGACCCCTCCAAGG - Intronic
1002638566 5:180619844-180619866 TGTCCTCCTGGACCTCTGCACGG - Intronic
1002955702 6:1861371-1861393 GCCCCTCCTGGTCCTCTAGACGG - Intronic
1008587179 6:52960631-52960653 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1009872614 6:69469636-69469658 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1014258637 6:119189796-119189818 GGGCCTCCTGGAGCACAAGATGG - Exonic
1023034441 7:36118448-36118470 GGATCTCCTGCCCCACTAGATGG + Intergenic
1032591137 7:133193513-133193535 GGTCTTCCTGGACAACTGGAGGG + Intergenic
1033759425 7:144423423-144423445 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1034079040 7:148259612-148259634 GGTTCTCCTGGACCGGTGGAGGG - Intronic
1034759480 7:153657985-153658007 TGTCCTCCTGGCCCAGCAGACGG + Intergenic
1038198001 8:25385517-25385539 GGTCCTCCTGTCCCAGTAAATGG - Intronic
1038638615 8:29306476-29306498 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1039893850 8:41702230-41702252 GGTCCTCCTGAACAACTAGAAGG - Intronic
1040965242 8:53075679-53075701 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1041001724 8:53461002-53461024 TGTCCTCCTAGACCACAAAAAGG - Intergenic
1041446169 8:57953385-57953407 AGTCTTCCTGGAGCACTAGTTGG + Intergenic
1041547132 8:59058388-59058410 GCTCCTTCTGGACCACTTGAAGG - Intronic
1045385521 8:101667953-101667975 CTTCCTCCTGGGCCACCAGATGG + Exonic
1049680842 8:143917376-143917398 GGTCATCGTGGACCCCGAGACGG - Exonic
1049987229 9:962593-962615 GGCCCTCCTGGACCACAGCATGG - Intronic
1050935150 9:11386859-11386881 AGTCCTCCTGGACAACTAGCTGG - Intergenic
1057840802 9:98484383-98484405 GGTTCTCCTTGACCATTAGAGGG + Intronic
1059292319 9:113237300-113237322 GCTCCTCCTGGACAACTTAATGG + Intronic
1061132421 9:128715368-128715390 GGTCCTCCTGGTCCAGTTCAAGG + Exonic
1061918288 9:133768640-133768662 GGGCCTCCTGGATCACTGGTTGG - Intronic
1191160877 X:57328938-57328960 GGTCCTCCTGGACCACTAGAAGG + Intronic
1191206117 X:57835499-57835521 TTTCCTCCTAGACCACAAGAAGG + Intergenic
1192870225 X:75177416-75177438 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1195044266 X:101042057-101042079 AGCCATCTTGGACCACTAGATGG - Exonic
1196662145 X:118280503-118280525 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1199832593 X:151560714-151560736 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1201272097 Y:12265278-12265300 TTTCCTCCTAGACCACAAGATGG + Intergenic
1201429509 Y:13890367-13890389 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1201496581 Y:14595904-14595926 TGTCCTCCTAGACCACAAGGAGG + Intronic
1202395686 Y:24421320-24421342 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1202475099 Y:25248772-25248794 TGTCCTCCTAGACCACAAGGAGG + Intergenic