ID: 1191161452

View in Genome Browser
Species Human (GRCh38)
Location X:57333957-57333979
Sequence GAGCAAAGACAGAATTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191161451_1191161452 -9 Left 1191161451 X:57333943-57333965 CCTTATCTGTAGAAGAGCAAAGA 0: 1
1: 1
2: 13
3: 58
4: 389
Right 1191161452 X:57333957-57333979 GAGCAAAGACAGAATTATATTGG 0: 1
1: 0
2: 2
3: 10
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191161452 Original CRISPR GAGCAAAGACAGAATTATAT TGG Intronic
900104152 1:975202-975224 AAGAAAAGATAGAATTTTATTGG + Exonic
902155601 1:14483091-14483113 GAGCAAAATCAGAATAATAATGG - Intergenic
903799948 1:25959381-25959403 GAGCACAGACAGATATATAATGG - Intergenic
906161727 1:43654598-43654620 GAGTAAAAACAGAATGCTATTGG + Intronic
909023307 1:70455974-70455996 AAGGAGAGAAAGAATTATATTGG + Intergenic
909331664 1:74420043-74420065 GAGAAAAGACAAAATAATTTAGG + Intronic
909562516 1:77022413-77022435 AAGCAAATACTGCATTATATTGG - Intronic
911285543 1:95987739-95987761 GTCCAAACACAGAAATATATTGG + Intergenic
911612474 1:99971608-99971630 GAAAAAAGAAAGAATCATATTGG - Intronic
912892108 1:113544809-113544831 AAGCAAAGTAAGAATTGTATAGG - Intronic
914890330 1:151616186-151616208 GTGCAAAGACATATTTATTTTGG - Intronic
916313026 1:163417707-163417729 GAAAAAAGACAAAATTATAAAGG + Intergenic
916548619 1:165828810-165828832 GAGCAAAGAAAGAACCATCTGGG - Intronic
917550566 1:176023295-176023317 GAGAAAATACATAATTATAGTGG + Intronic
918846994 1:189628876-189628898 GAACCAAGACAGAATTATATTGG + Intergenic
919251057 1:195056560-195056582 AAGCAAAAATAGAATTAGATAGG - Intergenic
919461053 1:197878027-197878049 GATCAAAGACTAAATTATAAGGG - Intergenic
919965509 1:202519620-202519642 GAGAAAAGAAAGAATAAAATTGG - Intronic
921883670 1:220281541-220281563 GACCAAAGCCAGAAATAAATGGG + Intergenic
923959748 1:239065005-239065027 GAGGAAAGATAAAATTATTTAGG + Intergenic
1063013474 10:2049800-2049822 GGGCTATGACAGAATCATATAGG + Intergenic
1064295496 10:14075487-14075509 GAGCAACGACAGAAAGAGATAGG - Intronic
1064704018 10:18051673-18051695 GAGAAAAATAAGAATTATATTGG + Intergenic
1067832583 10:49618881-49618903 GAACACAGAGAGAATTAAATGGG - Intronic
1067959286 10:50829742-50829764 TACCAAAGCCAGAATTATGTGGG - Intronic
1069279503 10:66637579-66637601 GAGCAAAGCCAGAATGCTGTGGG - Intronic
1069289528 10:66760549-66760571 GAGAAAAGAGAAAATTATATGGG - Intronic
1069324817 10:67220358-67220380 TATCAAAGAAAGAATGATATAGG - Intronic
1070410610 10:76136320-76136342 CTGCAAAAACAGAATTATCTAGG - Intronic
1074415091 10:113260771-113260793 GAGCAAAGTCAGAATGCTGTGGG - Intergenic
1074459678 10:113625708-113625730 GAGCCAGGAGAGAATTATCTTGG - Intronic
1075945659 10:126430871-126430893 GAGAATAGACAGAATTTTCTAGG + Intronic
1075953835 10:126505439-126505461 GAGGAAAGACAGAATTCTGGAGG + Intronic
1077548810 11:3190181-3190203 GTGCAAAGACACAAATAAATAGG + Intergenic
1079145272 11:17845757-17845779 TAGAAAAGAGAGAATTGTATTGG - Intronic
1080392047 11:31857449-31857471 GGCCAGAGGCAGAATTATATAGG + Intronic
1080437354 11:32257646-32257668 GGACAAAGCCAGAATTATTTTGG + Intergenic
1081087343 11:38817820-38817842 GGGCAAATATAGAATTAAATAGG + Intergenic
1081231640 11:40591911-40591933 AAGCAAAGAAAGAATTCGATTGG - Intronic
1081945017 11:46984520-46984542 AAGGAAAGAAAGAAATATATTGG - Intronic
1084843036 11:71873548-71873570 GAACAAAGACTGAATGAAATAGG + Intronic
1085980272 11:81716410-81716432 GAGAAAGGTCTGAATTATATGGG + Intergenic
1087247997 11:95862545-95862567 GAAGAAACACAGAATTAAATGGG + Intronic
1087305530 11:96485304-96485326 GAGCAAAGAGACATTTATAGAGG + Intronic
1087747410 11:101964807-101964829 TAGTAATGACAGAATAATATGGG - Intronic
1087998553 11:104844119-104844141 AAGCAAAGGCAAAATTAAATAGG + Intergenic
1088547922 11:110980364-110980386 AAGCAAAGAAAGAAATTTATTGG + Intergenic
1090274820 11:125411828-125411850 GAGCCAAGAACGCATTATATTGG - Exonic
1092576385 12:9787940-9787962 AAGCAAAAACAGAATTAAAGGGG - Intergenic
1093010231 12:14099754-14099776 GACCAAAGTCACAAATATATAGG + Intergenic
1093438247 12:19162896-19162918 AATCTAAGACAGAATTTTATAGG + Intronic
1095865605 12:46968742-46968764 GACCAAAGAAAGAATTAAAATGG + Intergenic
1099987204 12:89680430-89680452 GAAAAAAGACAAAATTATTTTGG + Intronic
1100075166 12:90771862-90771884 TAGCAAAGACAAAACTATAATGG - Intergenic
1103285889 12:119801459-119801481 GGGAAAAGGCAGAATGATATGGG - Intronic
1105728981 13:23192742-23192764 GAGTAAAGATAGAATAATTTAGG + Intronic
1105784557 13:23735529-23735551 GAGCAAGGTCATATTTATATTGG - Intronic
1107635414 13:42387283-42387305 GAGTAGAGAGAGAAGTATATTGG + Intergenic
1108852111 13:54743168-54743190 TAGCACAGACAGAATTACCTAGG - Intergenic
1108945473 13:56018092-56018114 GAGGAAAAACAGAAAGATATAGG - Intergenic
1110213814 13:73004188-73004210 GAGCAAAGAAAATATGATATTGG + Intronic
1110343423 13:74418674-74418696 CAGCAAAGAAAGAAATAGATTGG - Intergenic
1111739864 13:92190338-92190360 GAGAGAAGAAAAAATTATATAGG + Intronic
1113202475 13:107882343-107882365 GTGTAAAGACAGAATTCAATAGG + Intergenic
1113315300 13:109173552-109173574 GAGGAAAGAAACAATTATGTAGG + Intronic
1114145105 14:19966145-19966167 GACCAAAGAAAGAATTACAAGGG + Intergenic
1114350787 14:21848738-21848760 GAGCAAAGTCAAAATTAGTTAGG + Intergenic
1114359851 14:21959402-21959424 GAGGAAAGGCTGAATTAGATAGG - Intergenic
1115076910 14:29403607-29403629 GAGCAAGAACAGACTTTTATTGG + Intergenic
1115150687 14:30281658-30281680 GATCACAGACAGAAGTATACTGG + Intergenic
1115699718 14:35939956-35939978 GAGCAAATCCAGAATCATATTGG + Intergenic
1115720080 14:36151241-36151263 GAACAAGGATAGAGTTATATTGG - Intergenic
1116089269 14:40284242-40284264 GAGGAAAAACAGATTTACATAGG + Intergenic
1117503707 14:56379724-56379746 GAGCAGAGACAGTACTATTTTGG - Intergenic
1117519515 14:56536634-56536656 GAGTCAAAACAAAATTATATTGG - Intronic
1117699484 14:58398537-58398559 GAGAACAGACACAATTATTTTGG + Intronic
1120084523 14:80255021-80255043 GAGCAAAGCCATAACTATGTAGG + Intronic
1120269748 14:82296371-82296393 GTGCAAAAACAGAATAATAGAGG - Intergenic
1120523593 14:85552311-85552333 GAGAAAAGTGAGGATTATATAGG - Intronic
1120702348 14:87711977-87711999 GGGGAAAGACAAAAGTATATAGG + Intergenic
1120794946 14:88622459-88622481 CAGCAAAGACAGAGTAATGTTGG + Exonic
1121256468 14:92533973-92533995 CAGCAATGACAAAATTCTATTGG + Intronic
1121587534 14:95072859-95072881 TTGCTAAAACAGAATTATATTGG - Intergenic
1125137041 15:36355492-36355514 GAGCTAAGAGATAATTATCTAGG + Intergenic
1130010471 15:80149432-80149454 GACTAAAGACAGAATTAAAGAGG + Intergenic
1133582519 16:7159738-7159760 GAGGAAAGACAGAAATTTCTGGG - Intronic
1135460016 16:22634200-22634222 GATCAAATACAAAATTATACAGG - Intergenic
1135579883 16:23616328-23616350 CAACAAATACAGAATTCTATGGG + Intronic
1137913232 16:52400359-52400381 GAGCAAAGACATAAAAATGTGGG + Intergenic
1138447278 16:57072045-57072067 AATCCAAGACAGAAATATATTGG + Intronic
1138740578 16:59304849-59304871 GAATAAAGACAGAAATATACTGG - Intergenic
1141353221 16:83318189-83318211 GAGAAAAGACAAGATTATGTAGG + Intronic
1141912297 16:87068272-87068294 GAGTATATTCAGAATTATATGGG + Intergenic
1142815352 17:2420604-2420626 GAGGAAAAACAGAATTTTGTGGG + Intronic
1144295200 17:13868350-13868372 GGGCAAAGGCAGAGTTAGATTGG - Intergenic
1145874675 17:28307876-28307898 GATCAAATACAGTATTATATGGG - Intergenic
1146494236 17:33306755-33306777 GAGCAATGACATAATTACAATGG - Intronic
1146498682 17:33345681-33345703 AAGCAAAGACTGAATCATACAGG + Intronic
1149418641 17:56487004-56487026 TAGCAAAGACAAAATGATAAAGG + Intronic
1151311206 17:73293434-73293456 GAGAAAAGACAGGATCAAATGGG + Intronic
1154351597 18:13588156-13588178 GTGAAAAGACAGAATTATTTTGG + Intronic
1155712466 18:28899817-28899839 GAGAGATGACAGAATTATAAAGG - Intergenic
1155723403 18:29048514-29048536 TAGCAAATACTGAATTATACAGG + Intergenic
1157194565 18:45610321-45610343 GAGCATAGACAGAAAGATCTAGG + Intronic
1168016648 19:53579245-53579267 GAGTAAAGACAGAATGGTACTGG - Exonic
1168491996 19:56818750-56818772 GTTCAAAGACAGAATAATGTTGG + Intronic
925080486 2:1059874-1059896 AAACTAAGACAGAGTTATATTGG + Intronic
925691282 2:6525829-6525851 GAGCAAAGACAAAATTGCCTTGG - Intergenic
926530899 2:14043855-14043877 AAGCAAAGAAAAAATTGTATTGG - Intergenic
926838209 2:17048204-17048226 GTGAAAAGAGAGAAATATATGGG - Intergenic
929606029 2:43234811-43234833 GGGCAAAAACAAAATTATCTGGG - Intronic
930319989 2:49842768-49842790 GAGCACAGAGGGAATTATAATGG - Intergenic
932487956 2:72096775-72096797 GAGCAAAGATAGAAAAATAGAGG - Intergenic
933988617 2:87616282-87616304 AACTAAAGACAGAATTATTTAGG + Intergenic
935310713 2:101780473-101780495 GACAAAACACAGAATTATGTGGG - Intronic
936305223 2:111334527-111334549 AACTAAAGACAGAATTATTTAGG - Intergenic
936384606 2:112017730-112017752 GAGCAAAGACCAAATGATCTGGG + Intronic
939285594 2:140124834-140124856 GAACAAATACAAAATTGTATTGG + Intergenic
939526979 2:143307330-143307352 GTGAAAAGAGAGGATTATATTGG + Intronic
940018449 2:149131521-149131543 GAGGAAAGAGAGAATTGTCTTGG + Intronic
942146043 2:173027675-173027697 CAGCCCAGACAGAATTAAATCGG + Intronic
942264412 2:174206951-174206973 AATCAAAGACAGCTTTATATTGG + Intronic
942340615 2:174941511-174941533 GAGCAAAGAAATAATTTTACTGG - Intronic
942835367 2:180289419-180289441 TAGAAAAGACAAAATTCTATTGG - Intergenic
943463305 2:188196826-188196848 GAACAAAGACAGAATAAATTTGG + Intergenic
944334032 2:198508104-198508126 GGTCAAAGACAGAATTAGAAGGG + Intronic
945423024 2:209661978-209662000 GAGCAAAGACAGATTTTTATGGG - Intronic
946047329 2:216832276-216832298 GTACAAAAACAGAATTCTATGGG + Intergenic
946484856 2:220091323-220091345 AAGGAAAGACAGTATTGTATGGG - Intergenic
1169717672 20:8638865-8638887 ATGCAAAGACAGAATCATGTTGG - Intronic
1170156670 20:13275167-13275189 GAGAAAAGAAATAAATATATGGG - Intronic
1176936271 21:14871121-14871143 GAGAAAAGACACAATTTGATTGG + Intergenic
1177534599 21:22407387-22407409 GAGGAAAGACTGATTTATTTTGG + Intergenic
1177736402 21:25096138-25096160 CAGTAATGAAAGAATTATATGGG + Intergenic
1183036581 22:35145093-35145115 GAGAAAAGACAGGATGATGTTGG - Intergenic
1183238638 22:36639432-36639454 GAGCAAAGAGGGACTTATGTGGG + Intronic
949305793 3:2639275-2639297 GAACTAGGACAGAATTAAATAGG - Intronic
951240718 3:20283222-20283244 GGGCAAAAGCAGAATTATAACGG - Intergenic
951363859 3:21756660-21756682 GAGCAAAAGCACAAGTATATGGG + Intronic
952695307 3:36258560-36258582 AAGGAATGACAGAATTATAATGG + Intergenic
952797587 3:37255501-37255523 AAACAAAGACAGATTTATTTGGG + Intronic
953946515 3:47153396-47153418 GAGCTAAGACAAAATTTGATAGG - Intronic
955545196 3:60020664-60020686 GAGCAAATAATGAATTATACAGG - Intronic
955617812 3:60827332-60827354 GAGCAAAGCCAGCATTCTACTGG - Intronic
955782745 3:62503396-62503418 GAGCAAAGAAAGCAATCTATGGG + Intronic
956276481 3:67507245-67507267 GAGCAAGCACAGATTTCTATCGG + Intronic
956435493 3:69231178-69231200 GAGGAAAGAGGGAATTTTATTGG + Intronic
958778982 3:98519271-98519293 GAACAAAGACTGAAATAAATAGG + Intronic
959207842 3:103334996-103335018 GAACAAAGACATAATAATTTAGG - Intergenic
959271179 3:104212502-104212524 TAGTAAAGACAGAATTATCATGG - Intergenic
960414280 3:117365262-117365284 GAGGAAAGAGATACTTATATTGG - Intergenic
962360591 3:134739620-134739642 GCGCAAAGACAGCAATCTATAGG + Intronic
962599459 3:136980196-136980218 CAACAAAGTCAGAATTATAATGG + Intronic
964158868 3:153621586-153621608 GAGAAAAGACAGAGAGATATGGG + Intergenic
964235832 3:154526221-154526243 GAGCAAAGAAAGTATTTTCTTGG - Intergenic
964335419 3:155649321-155649343 GGGCCGAAACAGAATTATATAGG - Intronic
964490340 3:157229101-157229123 GAGCAAAGACAGAATAGAACAGG - Intergenic
965936849 3:174124798-174124820 GAAGAAACACAGAATTTTATGGG + Intronic
966371595 3:179256110-179256132 GAGCAAATACAGAAGTAAACAGG + Intronic
966668894 3:182505331-182505353 GATCAAAGACAGTATTTTTTTGG - Intergenic
967760437 3:193218270-193218292 GTGCAAAGTCATAGTTATATTGG + Intergenic
969784123 4:9439606-9439628 GAACAAAGACTGAATGAAATAGG + Intergenic
971597088 4:28543873-28543895 GAGCAAAGACATGTTTAAATTGG + Intergenic
973188223 4:47355915-47355937 GAGCAAACACAGACTTAGAAGGG - Intronic
973243766 4:47987876-47987898 GTGCAAAGACAGAACTGTGTTGG + Intronic
973900230 4:55461895-55461917 GAATAAGGACAGAATTATAAAGG - Intronic
974069636 4:57111749-57111771 GAACAAAGACAAAAATATTTAGG - Intergenic
975194163 4:71503730-71503752 AATCAAACACAGAATTATAATGG - Intronic
976527127 4:86106547-86106569 GAGCACAGAAAGAATTCTAGAGG + Intronic
977115050 4:93013690-93013712 GTGCAAATACAGATTTACATAGG - Intronic
978456366 4:108896984-108897006 GAGCAGAGACAGAATTAAGAAGG - Intronic
978767267 4:112416974-112416996 CAGAAAAGACAGATTAATATAGG + Intronic
978887992 4:113788476-113788498 GAGAAAAGAAAGATTTATGTTGG + Intergenic
979218183 4:118191503-118191525 GAGCAAAGAAAGCATTCTCTAGG + Intronic
980179405 4:129385841-129385863 AAGGAAAGACAGAATTATGCAGG - Intergenic
980520325 4:133923800-133923822 GAGAAAAGAAAGAAAGATATAGG - Intergenic
981803193 4:148681877-148681899 GAGCAAATACAGTATTACAAGGG + Intergenic
982320295 4:154070367-154070389 AGGAAAAGACAGAATTTTATAGG + Intergenic
984250234 4:177323242-177323264 CAGAAAAGACAGAATGAGATTGG - Intronic
986812985 5:11379910-11379932 GAGCAAAGACAGAGTGGTAGGGG - Intronic
988030764 5:25759983-25760005 GAGAAATGCCAGAATTATTTTGG - Intergenic
989195540 5:38712919-38712941 GAGAAAAGCCAGAATTAAAAGGG + Intergenic
990178787 5:53136823-53136845 GAGAAAAGACTGAAAGATATCGG - Intergenic
990738080 5:58886044-58886066 GAGCCAAAAAAGAATTATGTTGG - Intergenic
990814786 5:59771548-59771570 AAGAAAAGAAAGAATGATATGGG + Intronic
992025161 5:72662819-72662841 GAGCAACAACAGAAATATGTTGG - Intergenic
992169595 5:74088538-74088560 GAGCAAAGAAAGTATGATTTTGG + Intergenic
993936091 5:94004723-94004745 TAGCAAATACTGAAATATATAGG + Intronic
994074067 5:95631451-95631473 GAGCAAAGAAATTATTTTATTGG - Intergenic
994408818 5:99380634-99380656 CAGCAAAGACAGAATTGAAATGG + Intergenic
994549634 5:101214763-101214785 CAGCAAAGACAGTATTAAGTGGG + Intergenic
995167481 5:109061974-109061996 AAACAAAGACAGAATCATCTTGG - Intronic
995486671 5:112646701-112646723 GAGCACAGCCAGAAGTATAGTGG - Intergenic
995779573 5:115761379-115761401 GAGCAAAGAGAGAATAAGAGAGG + Intergenic
996257430 5:121422437-121422459 GAGGAAAGATAATATTATATAGG + Intergenic
996432436 5:123396757-123396779 GAGGCAAGAGAGCATTATATGGG + Intronic
998440112 5:142152578-142152600 GAGCAAAGAAAGAAGTAGCTTGG + Exonic
998846320 5:146313844-146313866 GTGCAAAGACTGAATTACAAAGG + Intronic
999520932 5:152350009-152350031 GGGCAAAGAAAGCATTATAATGG + Intergenic
999547302 5:152643945-152643967 GAGCAAACAATGAGTTATATGGG - Intergenic
1000692015 5:164335823-164335845 GAGAAATGAAAGAATAATATTGG + Intergenic
1001871329 5:175158488-175158510 GTGTAAAAACAGAATTATAATGG + Intergenic
1004023653 6:11798110-11798132 GAGCAAGGACAGAATTCTGCAGG + Intronic
1006685709 6:35831599-35831621 GAGCAAATTCAGAATTAAAGGGG + Intronic
1006961063 6:37930767-37930789 TAGCAAAGACTTATTTATATAGG - Intronic
1007016493 6:38472875-38472897 GAGCAAAGATACATTTAAATTGG - Intronic
1009573158 6:65415626-65415648 GAGAAAAGACAAAAATAGATGGG + Intronic
1010784156 6:79980572-79980594 GAGAAAATACAAAATTATACGGG + Intergenic
1012004611 6:93696926-93696948 GAGCAAAAACTGAAGTATTTTGG + Intergenic
1014992425 6:128097976-128097998 TAGCAAAGACAAAATTCTAAGGG + Intronic
1016756628 6:147694398-147694420 GAGCAAAATCATAATTATTTGGG - Intronic
1016823859 6:148370482-148370504 AAGCAAAGAGAGAATTTAATAGG - Intronic
1022066338 7:26862581-26862603 GAGAGAAGGCAGAAATATATTGG + Intronic
1023099080 7:36694978-36695000 GTATAAAGACAGAATAATATTGG - Intronic
1023564013 7:41505650-41505672 GACAAAAGACAGAATTTTACAGG - Intergenic
1023786127 7:43709656-43709678 TAACAAAGACAGTGTTATATTGG - Intronic
1024093263 7:45965055-45965077 GAGCAAAGGCAGAATTTCAGAGG + Intergenic
1024532257 7:50403126-50403148 GTGCAAAGAGACATTTATATTGG - Intronic
1024603309 7:51005702-51005724 GAGCAAAGATAGAAATAAGTGGG - Intergenic
1025805522 7:64827960-64827982 AGGCAAACAGAGAATTATATCGG - Intronic
1027824148 7:83089400-83089422 GAGAAAGGACAGAGTTCTATAGG - Intronic
1027970076 7:85068927-85068949 GACCACAGACAGAATGACATTGG + Intronic
1028334412 7:89633854-89633876 GGGCTAAAACAGAATGATATTGG - Intergenic
1030662017 7:112230011-112230033 GAGCAAGGACTGCATTATAAAGG + Intronic
1033408507 7:141093929-141093951 GAGCAAAGACAAATTTTTAAAGG + Intronic
1034782839 7:153897073-153897095 TAGCACAGACAAAATTATTTTGG - Intronic
1035084790 7:156248739-156248761 GAGAAAAGACAGAATCGTACTGG + Intergenic
1038357256 8:26840903-26840925 GAGCAAACACAGCCTTATGTGGG + Intronic
1039244677 8:35595842-35595864 GTGCAAACACAGAAGTAGATGGG - Intronic
1040080423 8:43278607-43278629 AAGCACAGACAGCATTGTATTGG - Intergenic
1041139804 8:54805030-54805052 GATGAAAGTCAGAATAATATGGG - Intergenic
1043696395 8:83224107-83224129 GAACTAAGACAGAAATATATAGG + Intergenic
1043720157 8:83538227-83538249 GAGCAAATACACTATTATAATGG + Intergenic
1044874062 8:96646814-96646836 GAGCAGAGACAAAATGCTATGGG - Intronic
1045156013 8:99472464-99472486 GAACAAAGACATAATTATTTGGG + Intronic
1046254753 8:111681348-111681370 GTTGAAAGACAGAAATATATAGG - Intergenic
1046366451 8:113238368-113238390 ATGTAAAGACAAAATTATATTGG + Intronic
1046594437 8:116244702-116244724 GAACAAAGACAGAATGATCCAGG - Intergenic
1048152911 8:131911233-131911255 GAAGAAAGACATACTTATATTGG - Intronic
1048479684 8:134777294-134777316 GAGGAAAGAGAGAATTAGAGGGG + Intergenic
1053396867 9:37783336-37783358 GATCAGAGACAGAATCAAATAGG + Intronic
1057604448 9:96489165-96489187 GAGCAAAAACACAATTTTTTGGG + Intronic
1058017906 9:100056751-100056773 GATGAAATACAGAATTTTATAGG + Intronic
1059586530 9:115613572-115613594 GAGCAAAAAAAGAATAAGATAGG - Intergenic
1059858700 9:118432297-118432319 AAGCAAAGACAGAAATATAATGG + Intergenic
1061600974 9:131669804-131669826 AAGCACAGACAGAATTTCATTGG + Intronic
1186279155 X:7973785-7973807 GAGCAAAGACAGAAAAAAACTGG - Intergenic
1186547864 X:10469659-10469681 CACCAAAGACAGAAATAAATAGG + Intronic
1186919469 X:14262296-14262318 GAGAAAAGACTGAATAAAATAGG + Intergenic
1186948253 X:14593544-14593566 GATTAAAGACAGAATTCTATTGG + Intronic
1188688747 X:33103034-33103056 GAGCAAAATCAGAGTTCTATTGG + Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190021603 X:46883344-46883366 TAGCAAAGGAAGCATTATATTGG - Intergenic
1190780579 X:53590915-53590937 GACCAATGACAGAATAATAAGGG + Intronic
1191161452 X:57333957-57333979 GAGCAAAGACAGAATTATATTGG + Intronic
1192924596 X:75742274-75742296 TATCAAAGACAGAATTAGATTGG - Intergenic
1194299607 X:92169343-92169365 GAGCTAAGACTGAATTTTAGGGG + Intronic
1195438164 X:104869504-104869526 AAGCAAAAAAAGAATTATACAGG - Intronic
1195938718 X:110148918-110148940 GAGGGAAGACAGAGTTGTATGGG - Intronic
1196045470 X:111251747-111251769 GAGCAAAGAAAGATATATAAAGG + Intronic
1196594985 X:117534783-117534805 AAGCAAAGAAAGAACTATTTAGG + Intergenic
1196649132 X:118150973-118150995 AAGCAAAAACAGAATCAAATTGG - Intergenic
1199149014 X:144406844-144406866 GATCAAAGACACAAATAAATGGG + Intergenic
1200020959 X:153207416-153207438 GAGCAAAGACAGAAAAAGACTGG - Intergenic
1200617251 Y:5394504-5394526 GAGCTAAGACTGAATTTTAGGGG + Intronic
1200676979 Y:6160666-6160688 GTGCATAGAGAGAAATATATAGG - Intergenic
1200804124 Y:7414822-7414844 GGACAAAGACAGGATTATATAGG - Intergenic
1201334971 Y:12870815-12870837 GAGCTATGTCAGAATTAGATAGG - Intergenic
1201942476 Y:19474639-19474661 AAGCAAAAACAGGTTTATATAGG - Intergenic