ID: 1191170575

View in Genome Browser
Species Human (GRCh38)
Location X:57443209-57443231
Sequence CGGTGAGAATGGAATCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9979
Summary {0: 1, 1: 65, 2: 2116, 3: 4766, 4: 3031}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191170575_1191170579 12 Left 1191170575 X:57443209-57443231 CCAACTTGATTCCATTCTCACCG 0: 1
1: 65
2: 2116
3: 4766
4: 3031
Right 1191170579 X:57443244-57443266 ACACCAATCAGATGTAGATTTGG 0: 944
1: 3601
2: 2455
3: 1611
4: 1157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191170575 Original CRISPR CGGTGAGAATGGAATCAAGT TGG (reversed) Intronic
Too many off-targets to display for this crispr