ID: 1191170575 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:57443209-57443231 |
| Sequence | CGGTGAGAATGGAATCAAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9979 | |||
| Summary | {0: 1, 1: 65, 2: 2116, 3: 4766, 4: 3031} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1191170575_1191170579 | 12 | Left | 1191170575 | X:57443209-57443231 | CCAACTTGATTCCATTCTCACCG | 0: 1 1: 65 2: 2116 3: 4766 4: 3031 |
||
| Right | 1191170579 | X:57443244-57443266 | ACACCAATCAGATGTAGATTTGG | 0: 944 1: 3601 2: 2455 3: 1611 4: 1157 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1191170575 | Original CRISPR | CGGTGAGAATGGAATCAAGT TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||