ID: 1191170880

View in Genome Browser
Species Human (GRCh38)
Location X:57445900-57445922
Sequence CTGTAGTCCTTGAGGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191170871_1191170880 30 Left 1191170871 X:57445847-57445869 CCAAAATCAATTGCCTCTGAGAG 0: 1
1: 0
2: 2
3: 19
4: 172
Right 1191170880 X:57445900-57445922 CTGTAGTCCTTGAGGTCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 126
1191170872_1191170880 17 Left 1191170872 X:57445860-57445882 CCTCTGAGAGAACAGTGCAGCTC 0: 1
1: 0
2: 1
3: 19
4: 160
Right 1191170880 X:57445900-57445922 CTGTAGTCCTTGAGGTCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 126
1191170876_1191170880 -5 Left 1191170876 X:57445882-57445904 CCAGGGTTTTTCCAAGGCCTGTA 0: 1
1: 0
2: 0
3: 17
4: 130
Right 1191170880 X:57445900-57445922 CTGTAGTCCTTGAGGTCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191170880 Original CRISPR CTGTAGTCCTTGAGGTCTGA TGG Intronic
902323472 1:15683995-15684017 CCGGAGTCCCTGGGGTCTGAGGG + Intergenic
902323510 1:15684114-15684136 CTGGCGTCCCTGGGGTCTGAGGG + Intergenic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
910366950 1:86476006-86476028 AAGCAGACCTTGAGGTCTGATGG + Intronic
910763601 1:90759002-90759024 CTCTAGTTCTTGATGGCTGATGG - Intergenic
914428828 1:147601130-147601152 CTGTCCTCCAAGAGGTCTGAAGG + Intronic
916461572 1:165030014-165030036 CTTTATTCCTTCAGGTCTGTGGG + Intergenic
918085029 1:181238010-181238032 CTGTTGGCCCTGAGGTCTCAAGG - Intergenic
920198546 1:204245236-204245258 CTGTTGTCCCTGAGGTGTCAAGG + Intronic
921558010 1:216622455-216622477 CTGTATTCCTAAAGGGCTGAAGG - Intronic
923448664 1:234096204-234096226 CTGTACTCCTTTATCTCTGAAGG + Intronic
924858453 1:247897590-247897612 CCCTGGTCCTTGAGATCTGAAGG + Intergenic
1063639540 10:7816457-7816479 CTGAAGTCCTTCAGTCCTGAGGG - Intergenic
1067264708 10:44729730-44729752 CTGTAGTCTTTGAACTCTCATGG + Intergenic
1069582756 10:69576700-69576722 CGGGAGTCCTGGAGGTCTTAGGG - Intergenic
1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG + Intergenic
1077163893 11:1126528-1126550 CTATAGTCCCAGAGGCCTGATGG + Intergenic
1078335223 11:10457953-10457975 GGGAAGTCCTTGATGTCTGAGGG - Intronic
1083749312 11:64752685-64752707 CTCCCGTCCTTGAGCTCTGATGG + Intronic
1084657562 11:70528206-70528228 CAGGCGTCCCTGAGGTCTGAGGG + Intronic
1090593245 11:128294062-128294084 CTGTGGTCCTTGCGGTGAGAGGG - Intergenic
1091073940 11:132596529-132596551 CTCTAGTCCTTGGGGTCTAGGGG - Intronic
1092711526 12:11342656-11342678 ATTTAGTCCCTGTGGTCTGAGGG + Intergenic
1097882011 12:64694770-64694792 CTGTAGTTCTGGAAGGCTGAAGG - Exonic
1097950149 12:65418843-65418865 CTGAAGTCCTTGATGTCTTCTGG + Intronic
1100016693 12:90019884-90019906 CTGTAGTCCTTGAGGTCTTTTGG + Intergenic
1108573227 13:51769961-51769983 CTGTGTTCCCTGAGGTCTGTGGG - Intronic
1110237588 13:73232651-73232673 CTGTAGTCCTACAGGTGGGAAGG - Intergenic
1110615469 13:77536785-77536807 CTGTAGTACTTGAGTTCTCATGG + Intronic
1112348068 13:98609370-98609392 CTGTATTCCTTCTGTTCTGAAGG + Intergenic
1115787024 14:36837570-36837592 CTGGAGTCCTTGAGGGCTGTGGG + Intronic
1117065341 14:52008277-52008299 CTGATGTCCTTGAGGGCTGTTGG + Exonic
1130685693 15:86035397-86035419 CTGTAGGCCTTTATTTCTGAAGG - Intergenic
1134388228 16:13794133-13794155 CTGGCTTCCTTGAGGTCTGGGGG - Intergenic
1134852850 16:17495833-17495855 CCATAGACTTTGAGGTCTGATGG - Intergenic
1137585071 16:49659482-49659504 CTGAGGCCCTTGAGGTCTGAGGG + Intronic
1141176906 16:81726733-81726755 CTTTAGTGCTTGGGGTTTGATGG - Intergenic
1141462608 16:84186721-84186743 CTGTAGCCTTGGAGGTCTAAAGG - Intronic
1144708557 17:17385747-17385769 TTGAGGTCCTTGAGGTCAGAGGG - Intergenic
1146624869 17:34427578-34427600 ATATAGGCCTTGGGGTCTGAAGG - Intergenic
1147643487 17:42019714-42019736 CTCTAGACCGTGAGTTCTGATGG + Intronic
1148701911 17:49592753-49592775 CTGTAGTCATTGGAGTCTAATGG - Intergenic
1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG + Intergenic
1164683802 19:30153386-30153408 CTGAAGTCCCTGAGGCCTGCAGG + Intergenic
1166633090 19:44425194-44425216 CTGCAGTCCTTGAGGTCTCACGG - Intronic
926606829 2:14906593-14906615 CTGGAGTCCTGAAGCTCTGAGGG + Intergenic
927573057 2:24176470-24176492 CTGTAATCCTAGTGCTCTGAAGG - Intronic
927662201 2:25002537-25002559 CTGTAGTCTATGAGCTCTGTAGG + Intergenic
929557868 2:42936753-42936775 CTGGGGTCCTTGAGGAATGAGGG + Intergenic
930890563 2:56381479-56381501 CTGAATTGCCTGAGGTCTGATGG - Intronic
931815811 2:65899372-65899394 CTGTAGTCTGTGTTGTCTGATGG + Intergenic
932893652 2:75617805-75617827 CTCAGGTCCTTGAGGGCTGAGGG - Intergenic
933946808 2:87293929-87293951 CTTTGGGCCTTGAAGTCTGATGG - Intergenic
935861305 2:107333053-107333075 CTGTATTCCTTGATCTCTGCAGG - Intergenic
936249520 2:110857114-110857136 CTCTGGTCCTTGAGGTGTCACGG - Intronic
936333381 2:111567626-111567648 CTTTGGGCCTTGAAGTCTGATGG + Intergenic
939387019 2:141514150-141514172 GTGTAGTCCATGAGGGTTGAGGG - Intronic
939712254 2:145536806-145536828 CTGCAGTCCTGGAGGAATGAAGG - Intergenic
942515519 2:176748488-176748510 CTGTAGTCCCTGAGGTGGGATGG + Intergenic
942673610 2:178403508-178403530 CTGTAGTTCATGAAGTCTGCAGG + Intergenic
945007059 2:205419841-205419863 CTGTAACCCTTGAGGTATGGAGG - Intronic
946864857 2:224033779-224033801 CTGCCCTCCTTGAGGTCTGTTGG - Intronic
948238496 2:236408773-236408795 CTGGAGGCCTTGAGGTTTGAGGG + Intronic
1169587155 20:7097492-7097514 CTGTAGTTCTTGAAGACTCATGG - Intergenic
1171042319 20:21776847-21776869 CTGAAGTCATTGAGGTCAGCAGG - Intergenic
1171299078 20:24043628-24043650 CTGTGGTCCTTGAGGTATTTTGG + Intergenic
1172799192 20:37564413-37564435 CTGGAGTCTTTGAGGTCGGTGGG + Intergenic
1173790345 20:45824120-45824142 CTGCATTCCTTCAGGTCCGAGGG + Exonic
1175131473 20:56792894-56792916 CTACAGTTCTGGAGGTCTGAAGG - Intergenic
1175933639 20:62505166-62505188 CTGTGGTTCTTGAGCTCTGGAGG - Intergenic
1176038635 20:63052594-63052616 CTGGAGTCCTGGAGCTCAGAGGG + Intergenic
1179290770 21:40016008-40016030 CTGGCCACCTTGAGGTCTGAAGG + Intronic
1179608434 21:42533291-42533313 GTGAAGTCCTTGTGGTCAGAGGG - Intronic
1180085099 21:45504851-45504873 CTGGAGTCTTTCAGGACTGATGG - Intronic
1180124414 21:45779178-45779200 CTGTAGCCACTGAGGTCTCAGGG + Intronic
1181681302 22:24497573-24497595 CTTTACTCCTTGAAGTTTGAAGG + Intronic
1183197608 22:36364266-36364288 CTCTAGTCCTGCAGGGCTGAGGG + Intronic
1184006238 22:41711527-41711549 GTGAAGTTCCTGAGGTCTGATGG - Intronic
950578368 3:13846757-13846779 CTGCAGTCCCTGAGGACTGGGGG - Intronic
952990411 3:38826585-38826607 CTGGACTCCTTGGGGTCTGCAGG + Intergenic
957167484 3:76693750-76693772 CTGTAGTTCTAGATGTCTAAGGG + Intronic
960519939 3:118643101-118643123 CTGTAGGCATGGAGGTCTGAGGG - Intergenic
961198234 3:125021918-125021940 CTGGAGTCCTTGATCTCTGAGGG - Intronic
961842488 3:129727638-129727660 AGGTAGTCCTGAAGGTCTGAAGG + Intronic
961978547 3:131052766-131052788 CTGTAGGGCTTTAGGTCAGAGGG - Intronic
962477265 3:135766033-135766055 CTGTAGTATTTGAGACCTGAAGG - Intergenic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969078316 4:4598585-4598607 CTGTAGCCCTGGAGGCCTGAAGG + Intergenic
972789359 4:42356057-42356079 CTGTAGTCCCTTAGGTCTTTTGG - Intergenic
981206896 4:142052946-142052968 CTTTAGTCTTTGAGCCCTGAAGG - Intronic
984015534 4:174421563-174421585 CTGCAGTCCTAGAGCTCTCATGG - Intergenic
984811845 4:183802108-183802130 CTGTGCTCCCTGAGGTCTGGAGG - Intergenic
987163373 5:15168550-15168572 CTTTAGTCCTTTTGGCCTGAGGG - Intergenic
989128652 5:38082000-38082022 CAGTAATCCATGAGCTCTGATGG + Intergenic
989258916 5:39397279-39397301 CTGGAGTCCCTGTGCTCTGAGGG - Intronic
994604864 5:101954350-101954372 CTGTAGTGCTTCAGGTTTTAGGG + Intergenic
995378677 5:111507993-111508015 CTGTAGACAATGAGGTATGATGG - Intronic
995648430 5:114339876-114339898 CTGTTGTCATGGAGGTCTGTGGG - Intergenic
997431700 5:133845350-133845372 CTATGGTCCTTGAGGCCTGAGGG + Intergenic
998031274 5:138870672-138870694 CTGCTGTCCTTCAGGGCTGATGG + Exonic
1001136714 5:169108583-169108605 CTGTAACCCTTGAGGTCTTGAGG + Intronic
1002284311 5:178152094-178152116 CTGTAGTCCTGGAGAGGTGATGG - Intronic
1004406538 6:15338476-15338498 CTGTAGACATTGAGGACAGATGG + Intronic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1009321689 6:62298282-62298304 TTATAGTTCTTGAGGTCAGAAGG - Intergenic
1011822007 6:91264050-91264072 GTGTAAGCCTAGAGGTCTGAAGG + Intergenic
1013343408 6:109237091-109237113 CTGTTCTCCCTTAGGTCTGAGGG + Intergenic
1013663873 6:112326774-112326796 CCGAAGTCCTTCAGGTCTGGAGG - Intergenic
1014004330 6:116399512-116399534 CTGTAGTCCTTGGGATCCCAGGG - Exonic
1014458977 6:121672455-121672477 CTGTAGTCCTAGCTATCTGAGGG + Intergenic
1019806396 7:3129402-3129424 CTGAAGACCTTGGGGTCTGATGG + Intergenic
1022213810 7:28237936-28237958 CTTTAGATCCTGAGGTCTGAAGG + Intergenic
1023313455 7:38910941-38910963 CTGTAGTCCTAGAGGTTTATGGG - Intronic
1024287872 7:47775144-47775166 CAGAAGTCCTTGATGTCTGCTGG + Exonic
1025620153 7:63161920-63161942 CTGTAGTTTTTGAGAACTGAAGG - Intergenic
1026417065 7:70193163-70193185 CTGTGGTCCTTGAACTCTGATGG + Intronic
1029271249 7:99378180-99378202 CTGTAGTCCTGGCTATCTGAGGG - Intronic
1029292932 7:99516506-99516528 CTGGAGTCCTGGAGATCTGGGGG - Intronic
1029436551 7:100567092-100567114 CTGGAGTCCTTGTGGGCTGGAGG - Exonic
1032298058 7:130660483-130660505 CTGTAGGCCTGGTGGTATGAGGG - Intronic
1034981954 7:155484774-155484796 CTGTAGGCAGTGAGGGCTGAAGG - Intronic
1035487498 7:159237335-159237357 CTGAAGTCCATCAGGCCTGAGGG + Intergenic
1038158733 8:25016298-25016320 CCCTAGACCTTGAGATCTGAAGG - Intergenic
1039518754 8:38153752-38153774 CTGTCTTCCTTGGGGACTGAGGG - Intergenic
1041192235 8:55365834-55365856 CTGTAGGGCTAGAGGACTGAAGG + Intronic
1051921823 9:22275439-22275461 CTATAGTCCTTGACTCCTGACGG + Intergenic
1053278292 9:36799656-36799678 CTGGAGTCCTTGAGGACAGTGGG + Intergenic
1061191041 9:129082910-129082932 GTGCAGAGCTTGAGGTCTGACGG - Intronic
1061487465 9:130927590-130927612 GTGTAGTCCCTGAGGCCTGCTGG - Intronic
1062406445 9:136399075-136399097 CTGTGGTCCAGGAAGTCTGAAGG + Intergenic
1186250782 X:7663756-7663778 CTATAGTGCTTCAGGTCTGGTGG - Intergenic
1191170880 X:57445900-57445922 CTGTAGTCCTTGAGGTCTGATGG + Intronic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1195882875 X:109610980-109611002 CTGTATGCCTTGAGCACTGATGG + Intergenic
1197444564 X:126534877-126534899 CTGCAGTCCCTGTGGTCTGCAGG - Intergenic
1197571025 X:128150809-128150831 CTGGAGTCCTTGAATTTTGAAGG - Intergenic
1197613654 X:128667068-128667090 CTGTATTCCTGGAGGAATGAGGG - Intergenic
1198029852 X:132744379-132744401 CTGTAGTCCTTCAGATCTCAGGG - Intronic
1198712322 X:139518648-139518670 CTGAAATCATGGAGGTCTGAGGG + Intergenic
1199787753 X:151120043-151120065 TTGTAGTCATTGTGGTCAGAAGG + Intergenic