ID: 1191177439

View in Genome Browser
Species Human (GRCh38)
Location X:57519459-57519481
Sequence GATATGGTCAGAAACGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191177435_1191177439 11 Left 1191177435 X:57519425-57519447 CCTGGTTTCTAGTTATGGAGTAT No data
Right 1191177439 X:57519459-57519481 GATATGGTCAGAAACGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191177439 Original CRISPR GATATGGTCAGAAACGTATC TGG Intergenic
No off target data available for this crispr