ID: 1191182882

View in Genome Browser
Species Human (GRCh38)
Location X:57581327-57581349
Sequence ACACTGAGGCTGCCCCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191182882_1191182884 -2 Left 1191182882 X:57581327-57581349 CCAGGAGGGGGCAGCCTCAGTGT No data
Right 1191182884 X:57581348-57581370 GTTGATAGTAACTTTGATTTAGG No data
1191182882_1191182886 7 Left 1191182882 X:57581327-57581349 CCAGGAGGGGGCAGCCTCAGTGT No data
Right 1191182886 X:57581357-57581379 AACTTTGATTTAGGCCAGGTAGG No data
1191182882_1191182889 26 Left 1191182882 X:57581327-57581349 CCAGGAGGGGGCAGCCTCAGTGT No data
Right 1191182889 X:57581376-57581398 TAGGGTATTATAGTGTTAGCAGG No data
1191182882_1191182887 8 Left 1191182882 X:57581327-57581349 CCAGGAGGGGGCAGCCTCAGTGT No data
Right 1191182887 X:57581358-57581380 ACTTTGATTTAGGCCAGGTAGGG No data
1191182882_1191182885 3 Left 1191182882 X:57581327-57581349 CCAGGAGGGGGCAGCCTCAGTGT No data
Right 1191182885 X:57581353-57581375 TAGTAACTTTGATTTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191182882 Original CRISPR ACACTGAGGCTGCCCCCTCC TGG (reversed) Intergenic
No off target data available for this crispr