ID: 1191182883

View in Genome Browser
Species Human (GRCh38)
Location X:57581341-57581363
Sequence CAAAGTTACTATCAACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191182883_1191182886 -7 Left 1191182883 X:57581341-57581363 CCTCAGTGTTGATAGTAACTTTG No data
Right 1191182886 X:57581357-57581379 AACTTTGATTTAGGCCAGGTAGG No data
1191182883_1191182887 -6 Left 1191182883 X:57581341-57581363 CCTCAGTGTTGATAGTAACTTTG No data
Right 1191182887 X:57581358-57581380 ACTTTGATTTAGGCCAGGTAGGG No data
1191182883_1191182889 12 Left 1191182883 X:57581341-57581363 CCTCAGTGTTGATAGTAACTTTG No data
Right 1191182889 X:57581376-57581398 TAGGGTATTATAGTGTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191182883 Original CRISPR CAAAGTTACTATCAACACTG AGG (reversed) Intergenic
No off target data available for this crispr