ID: 1191182885

View in Genome Browser
Species Human (GRCh38)
Location X:57581353-57581375
Sequence TAGTAACTTTGATTTAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191182874_1191182885 28 Left 1191182874 X:57581302-57581324 CCTGGACATAGGTGGCTTGTTTG No data
Right 1191182885 X:57581353-57581375 TAGTAACTTTGATTTAGGCCAGG No data
1191182882_1191182885 3 Left 1191182882 X:57581327-57581349 CCAGGAGGGGGCAGCCTCAGTGT No data
Right 1191182885 X:57581353-57581375 TAGTAACTTTGATTTAGGCCAGG No data
1191182881_1191182885 4 Left 1191182881 X:57581326-57581348 CCCAGGAGGGGGCAGCCTCAGTG No data
Right 1191182885 X:57581353-57581375 TAGTAACTTTGATTTAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191182885 Original CRISPR TAGTAACTTTGATTTAGGCC AGG Intergenic
No off target data available for this crispr