ID: 1191182889

View in Genome Browser
Species Human (GRCh38)
Location X:57581376-57581398
Sequence TAGGGTATTATAGTGTTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191182882_1191182889 26 Left 1191182882 X:57581327-57581349 CCAGGAGGGGGCAGCCTCAGTGT No data
Right 1191182889 X:57581376-57581398 TAGGGTATTATAGTGTTAGCAGG No data
1191182881_1191182889 27 Left 1191182881 X:57581326-57581348 CCCAGGAGGGGGCAGCCTCAGTG No data
Right 1191182889 X:57581376-57581398 TAGGGTATTATAGTGTTAGCAGG No data
1191182883_1191182889 12 Left 1191182883 X:57581341-57581363 CCTCAGTGTTGATAGTAACTTTG No data
Right 1191182889 X:57581376-57581398 TAGGGTATTATAGTGTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191182889 Original CRISPR TAGGGTATTATAGTGTTAGC AGG Intergenic
No off target data available for this crispr