ID: 1191190163

View in Genome Browser
Species Human (GRCh38)
Location X:57658069-57658091
Sequence TGGAATATAAGCAGCACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191190156_1191190163 27 Left 1191190156 X:57658019-57658041 CCCTTATAATTTCATAAGAGGAT No data
Right 1191190163 X:57658069-57658091 TGGAATATAAGCAGCACCGCAGG No data
1191190155_1191190163 28 Left 1191190155 X:57658018-57658040 CCCCTTATAATTTCATAAGAGGA No data
Right 1191190163 X:57658069-57658091 TGGAATATAAGCAGCACCGCAGG No data
1191190157_1191190163 26 Left 1191190157 X:57658020-57658042 CCTTATAATTTCATAAGAGGATC No data
Right 1191190163 X:57658069-57658091 TGGAATATAAGCAGCACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191190163 Original CRISPR TGGAATATAAGCAGCACCGC AGG Intergenic
No off target data available for this crispr