ID: 1191191804

View in Genome Browser
Species Human (GRCh38)
Location X:57675831-57675853
Sequence TGACATCTGGTAACAACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191191804_1191191807 1 Left 1191191804 X:57675831-57675853 CCCTCTGTTGTTACCAGATGTCA No data
Right 1191191807 X:57675855-57675877 TCAAAGAAATAACCTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191191804 Original CRISPR TGACATCTGGTAACAACAGA GGG (reversed) Intergenic
No off target data available for this crispr