ID: 1191193393

View in Genome Browser
Species Human (GRCh38)
Location X:57691449-57691471
Sequence TTCTTCCAACTTTACTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191193392_1191193393 -8 Left 1191193392 X:57691434-57691456 CCAAGTTTGGGAGGATTCTTCCA No data
Right 1191193393 X:57691449-57691471 TTCTTCCAACTTTACTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191193393 Original CRISPR TTCTTCCAACTTTACTTTTT TGG Intergenic
No off target data available for this crispr