ID: 1191199719

View in Genome Browser
Species Human (GRCh38)
Location X:57766747-57766769
Sequence CTGAAGTTCTTGGGGATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191199719 Original CRISPR CTGAAGTTCTTGGGGATAGA TGG (reversed) Intergenic
902205598 1:14865996-14866018 TTGCAGTTCTAGGGGCTAGATGG - Intronic
903777348 1:25801052-25801074 CTGAAGACCCTGGGGACAGATGG + Exonic
903944959 1:26956773-26956795 TTGAAGCACTTGGGGATAAAGGG + Intronic
904701881 1:32362593-32362615 ATGAAGTCCTTGGGGAGAAAAGG + Exonic
905947266 1:41914055-41914077 CTGGAATTCTTGTGGATAAAGGG - Intronic
906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG + Intronic
907049977 1:51323433-51323455 CAGAAGGTATTGGGCATAGAAGG - Intronic
910026234 1:82657733-82657755 TTTTAGTTCTTGGGGATAAAAGG + Intergenic
911640506 1:100283501-100283523 CTGAAATGCTTGGGACTAGAAGG - Intronic
911739326 1:101369835-101369857 CTTAAGTTCTGAGGGAGAGAAGG + Intergenic
914674143 1:149895436-149895458 CTGAAGATCTTGGGGATCTTGGG - Intronic
914726471 1:150331816-150331838 CTGAACTTCTTTAGGACAGAAGG + Intronic
916668525 1:166989720-166989742 CAGAAGCTTTTGGGGATTGAAGG - Exonic
917785795 1:178456312-178456334 TTGAAGTTCTTTTGGTTAGAAGG + Intronic
918306320 1:183250127-183250149 CTGAATTTCCTGGGGAAACATGG - Exonic
919432417 1:197512802-197512824 CAGAAGTTTTTGGTGATAAAGGG - Intronic
920295058 1:204950901-204950923 GGGAAGTTCTTGGGGACTGAAGG + Intronic
923293801 1:232573373-232573395 CTGAAGTGCTTAGGGGTAAAAGG + Intergenic
924434298 1:244025092-244025114 CTGAAATGCTTGGGGCCAGAAGG + Intergenic
924794029 1:247279329-247279351 CTGAAGGTCTAGGTGATAAAAGG - Intergenic
1063040628 10:2333709-2333731 CTGAAGTTCTTGCGGTTCCAAGG - Intergenic
1063456693 10:6188174-6188196 CTGAAGTACTTAGGGACAAAAGG - Intronic
1063608027 10:7540039-7540061 TTTAAGTTTTTGGGGATGGAGGG - Intergenic
1066057809 10:31697913-31697935 CGGAAGTGCTTGGGGAGGGAGGG - Intergenic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066746283 10:38605631-38605653 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
1068165620 10:53328373-53328395 CTGAAGCTCATGAGGAGAGATGG - Intergenic
1068561762 10:58522876-58522898 CTGTAGTTCTGTGGGATCGATGG - Intronic
1071596577 10:86932224-86932246 CTGAAGTATTTAGGGATAAAGGG - Exonic
1071699722 10:87917401-87917423 CCAAAGTTAGTGGGGATAGAAGG - Intronic
1073611386 10:104947290-104947312 CTGTAGTTTTTGCGGATTGAGGG + Intronic
1073771711 10:106742217-106742239 CTGAAGTACTTGGGACCAGAAGG + Intronic
1073989759 10:109249167-109249189 ATGAAGTTATTGGGGAAAGGGGG + Intergenic
1074773888 10:116752165-116752187 CTGGAAGTCTTGGGGCTAGAAGG + Intergenic
1076899530 10:133330691-133330713 CTGGAGTTCTTTGTGAGAGAAGG - Intronic
1077337389 11:2011527-2011549 CTGAAGCTGCTGGGGGTAGAGGG - Intergenic
1079481239 11:20882607-20882629 CTGAAGTATTTAGGGGTAGAGGG - Intronic
1081495681 11:43607997-43608019 CTGAAGTTCATGCTGACAGATGG + Intronic
1082697699 11:56389989-56390011 GTGATGTTCTTGGGTTTAGACGG - Intergenic
1085370745 11:76002594-76002616 ATGAAGTATGTGGGGATAGAGGG + Intronic
1088991603 11:114958684-114958706 CAGAAGTTAGTGGGGAGAGAGGG + Intergenic
1090336434 11:125970933-125970955 CTGAATTTCTTAGGGAAATAGGG + Intronic
1090789023 11:130074013-130074035 CTGAAGTTCTCAGGGGTAAAGGG - Intronic
1202820373 11_KI270721v1_random:66709-66731 CTGAAGCTGCTGGGGGTAGAGGG - Intergenic
1091457297 12:617555-617577 CTGAAGCTCCTGGGGATAAAAGG + Intronic
1092841259 12:12543292-12543314 CTGATGTGCTTGAGGATAGTGGG + Intronic
1093109279 12:15129826-15129848 CTGAAGTTTTTGAGCATACAGGG + Intronic
1093878702 12:24379421-24379443 CTCAATTGCTAGGGGATAGAGGG - Intergenic
1096280552 12:50249180-50249202 CTGCAGAGCTTGGGGAGAGAGGG - Intronic
1098672190 12:73245913-73245935 CTGATGATCTTGGAGATAAAGGG - Intergenic
1099203867 12:79705970-79705992 CTGAACTTCATGGGGGCAGAGGG + Intergenic
1099842941 12:87989723-87989745 TAGAAGTTCTTGGGGAAATATGG - Intronic
1101711757 12:107273987-107274009 CTGAAGATATTGAGGATATAAGG - Intergenic
1102196745 12:111031317-111031339 CTGAAGTATTTAGGGATAAAGGG - Intergenic
1102740341 12:115201377-115201399 CTGAAGCCCTTAGGGAAAGAAGG - Intergenic
1104099261 12:125590882-125590904 CTCAAGTTCTAGTGGATACAGGG + Intronic
1105202299 13:18190913-18190935 CTGAGTCTCTTGGGCATAGAAGG + Intergenic
1105466872 13:20652043-20652065 CAGAAGTTATTGGGGATTGTGGG + Intronic
1105624714 13:22101623-22101645 CTGTAGTTCTGGGGGTTCGAGGG - Intergenic
1105881358 13:24609045-24609067 GGGAAGTTCTTTGGGAGAGAAGG - Intergenic
1106436694 13:29729575-29729597 CTGATGTTTTTGGGGGCAGAGGG + Intergenic
1107484187 13:40810732-40810754 GGGAAGTTCTTTGGGAGAGAAGG - Intergenic
1110078635 13:71282709-71282731 CTCCAGTTCTTGGGGGTGGAGGG + Intergenic
1110639664 13:77807980-77808002 CTGAAGTTCCTGGGGCTATCTGG + Intergenic
1111954960 13:94746746-94746768 CCTAAGTCCTTGTGGATAGAAGG - Intergenic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1113073569 13:106446404-106446426 CTGAAGTTCTTGCGTATGGCTGG + Intergenic
1113772944 13:112923225-112923247 CTGAAGTTCATGGAGATAAAAGG - Intronic
1114198853 14:20504724-20504746 CTGGAGTTCTTTGTGAGAGAAGG - Intergenic
1114773300 14:25453360-25453382 CTGAAGTTGTGGGGGAAGGAAGG - Intergenic
1115725167 14:36206544-36206566 CTGAAGTACTTGGGAGTAAAGGG - Intergenic
1118697595 14:68399693-68399715 CTGAAGTATTTGGGGATGAAAGG - Intronic
1120452995 14:84694924-84694946 CTGAACTTCTTTGGTATATATGG + Intergenic
1121391412 14:93578660-93578682 CTGAAGTGTTTAGGGATAAAAGG - Intronic
1121975686 14:98402031-98402053 CTGGAGTTCATCAGGATAGAGGG - Intergenic
1202906363 14_GL000194v1_random:75601-75623 ATGAAGTTTTTAAGGATAGAAGG - Intergenic
1123711491 15:22990985-22991007 TTGAAGTTCTGGAGGACAGAAGG - Intronic
1124597159 15:31101113-31101135 CTGAAGTTCTAGGAGAGACAGGG - Intronic
1124948135 15:34289798-34289820 CTGTATTTCTTTGGGATAGGTGG + Intronic
1126318121 15:47392585-47392607 TGGAGGTTCTGGGGGATAGAGGG - Intronic
1126720764 15:51576762-51576784 CTGATGATGTTGGGGATGGATGG - Intronic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1128390973 15:67182259-67182281 CTTATGTTCTGGGGGCTAGAAGG - Intronic
1129236715 15:74228139-74228161 CTGCAGTCCCTGGGTATAGAAGG + Intergenic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1129594604 15:76952523-76952545 ATGAAGTTCATGGAGATGGAAGG - Intronic
1130648303 15:85747489-85747511 CTTAAGTTTTGGGGGAAAGATGG + Intronic
1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG + Intronic
1133041085 16:3059949-3059971 AAGGGGTTCTTGGGGATAGAAGG - Exonic
1137298415 16:47121205-47121227 CTCAAATTCTTGGGGATCTAAGG + Intronic
1137950020 16:52774679-52774701 CTCAGCTTCATGGGGATAGAAGG + Intergenic
1140906848 16:79416250-79416272 ATGGAGTTCTTGGGGATTGAGGG + Intergenic
1141479791 16:84298877-84298899 CTGAAGGTCTTAGAGATAGAAGG - Intronic
1142617326 17:1143869-1143891 CTCCAGCTCTTGGGGATGGATGG + Intronic
1143367136 17:6415692-6415714 CGGAAGTTCCAGGGGATAGTGGG - Intronic
1144232971 17:13227712-13227734 CTGAAGGGCATGGGGAGAGATGG + Intergenic
1144410259 17:14993957-14993979 CAGAGGTTCTTGGGGAAGGATGG - Intergenic
1144608906 17:16691042-16691064 ATGAAGTTCTTAAGGATGGAAGG - Intronic
1145128721 17:20322258-20322280 ATGAAGTTCTTAAGGATGGAAGG - Intergenic
1145195955 17:20895351-20895373 ATGAAGTTCTTAAGGATGGAAGG + Intronic
1145959983 17:28881585-28881607 GTGTAGTGCTTGGGCATAGACGG - Intronic
1147190181 17:38733869-38733891 CTGTAGTTCTTTGGGGTGGAGGG - Exonic
1148478479 17:47944647-47944669 CTGAAGGGCTTCGGGAAAGATGG + Exonic
1154416982 18:14182268-14182290 ATGAAGTTTTTAAGGATAGAAGG - Intergenic
1156445582 18:37234322-37234344 CTGAACTTTTTGGGGAAATAAGG - Intergenic
1159783684 18:72689409-72689431 CTAACGTTCTGGTGGATAGACGG + Intergenic
1159963920 18:74577914-74577936 CTGCAGATCTTGGGCAAAGAGGG + Intronic
1160143807 18:76348233-76348255 CTGGAGTTCTTGGGGGTTCAGGG - Intergenic
1161491798 19:4566477-4566499 CAGATGGTCTTGGGGATAGGGGG - Intergenic
1162048584 19:8018095-8018117 CTGAAGTTCTTTATGATTGAAGG + Intronic
1162821578 19:13226545-13226567 CTGAACTTCTTGTGGATGAATGG + Intronic
1167144453 19:47673434-47673456 CTTGAGTCCATGGGGATAGATGG - Intronic
925056800 2:862791-862813 CTGAAGCTTTGAGGGATAGATGG - Intergenic
925599306 2:5591496-5591518 CTGAAGTTCAGGGAGATTGAGGG - Intergenic
926929863 2:18026499-18026521 CTGACCTTCTTTTGGATAGATGG + Intronic
927511841 2:23648869-23648891 CAGAAGTTCATGGGGTTAGTGGG - Intronic
927577446 2:24211114-24211136 CACAAGTTCTTGGGGACACAGGG + Intronic
928025314 2:27734918-27734940 CTGAAGTATTTAGGGATAAAGGG - Intergenic
928156411 2:28881011-28881033 CTGAAGTATTTAGGGATAAAGGG - Intergenic
929836347 2:45404226-45404248 TTGAAGATTTTGGGGAGAGACGG + Intronic
930072177 2:47375614-47375636 CTGAAGTACTTAGGGGTAAAGGG - Intronic
930275227 2:49303129-49303151 TTGAAGTTCATGTGGATACAAGG + Intergenic
932160897 2:69458542-69458564 CTGGAGTTCTTCGCGATAAAAGG - Intronic
934187922 2:89763129-89763151 CTGCAGGTCTTGGGGAGAGATGG - Intergenic
934308684 2:91844819-91844841 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
939999942 2:148957148-148957170 CTGAAGTTCTTTTGGAAACAAGG + Intronic
940032296 2:149276538-149276560 CAGATGTTATTGTGGATAGATGG + Intergenic
941469525 2:165867192-165867214 CTGAAGTACTTAGGGGTACAGGG + Intronic
941576192 2:167233507-167233529 CTGAAGTTCTAGGGTAAAGAGGG + Intronic
941865949 2:170334815-170334837 GTGAAGTTCCTGGGTAGAGAAGG - Intronic
944236435 2:197445426-197445448 TTGTGGTGCTTGGGGATAGAGGG + Intergenic
948613046 2:239181549-239181571 ATGAACTTCTTGGGGATGGTGGG + Intronic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169425415 20:5493041-5493063 CTGAAGTCCTTGAGGATACCTGG - Intergenic
1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG + Intergenic
1169962690 20:11179340-11179362 CAGAAGTTCTTAGAGAAAGACGG - Intergenic
1170609065 20:17896726-17896748 CTGAAGCTTTGGGAGATAGAGGG + Intergenic
1171432346 20:25091025-25091047 CTGAAGTCCTGGGGGGCAGAGGG + Intergenic
1171510061 20:25674863-25674885 CTGAATCTCTTGGGGACACATGG + Exonic
1172701059 20:36854019-36854041 CTGAGGTCTTTAGGGATAGAAGG + Intronic
1172784016 20:37454180-37454202 CTGAAGGGATTGGGGTTAGAAGG - Intergenic
1173150240 20:40561194-40561216 CTGAAGTTCTTGCAGATGGTGGG - Intergenic
1173293436 20:41734463-41734485 CTCAAGCTCTTGGGAATGGAGGG + Intergenic
1173332825 20:42089433-42089455 CTGAAGATATTGGGGATAATAGG - Intronic
1176625708 21:9090400-9090422 ATGAAGTTTTTAAGGATAGAAGG - Intergenic
1177009607 21:15716095-15716117 CTGCAGTCCTTGGGGATGTATGG + Intergenic
1178911579 21:36678658-36678680 CTAAAGTATTTGGGGATAAAGGG + Intergenic
1179484022 21:41698067-41698089 CTGAGGTTCCTGGGGAGGGAAGG + Intergenic
1184562737 22:45272799-45272821 CAGGAGTTCTTGTGGATGGAGGG - Intergenic
1184829794 22:46977416-46977438 CTGAGCTTCTTGGGGACAGAGGG - Intronic
1185021285 22:48377748-48377770 CTGAAGTGCTTGGGACCAGAAGG + Intergenic
951088417 3:18542366-18542388 CTGATGTTCGTGGTGGTAGATGG + Intergenic
951379440 3:21965777-21965799 CTGAAGTATTTAGGGATAAAAGG + Intronic
955060944 3:55490905-55490927 CTGAAGTCCTTGGGACTAGACGG - Intergenic
956139782 3:66134306-66134328 TTGAAGTTTTTGTGAATAGAAGG + Intronic
959080384 3:101794685-101794707 GTGTAGTTCTTGGGTAGAGAAGG + Intronic
961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG + Intergenic
962653921 3:137523399-137523421 TTGAAGATCTTGGGAATGGAGGG - Intergenic
965107368 3:164373983-164374005 CTTGTGTTCTTGGGGTTAGATGG + Intergenic
965863412 3:173174635-173174657 GTGAAGTGGTTGGGGAGAGATGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
973540223 4:51927936-51927958 CTGCAGTTCTGGGAGTTAGAAGG - Intergenic
974664421 4:64939342-64939364 CTGAAGTACTTGGAGTTCGATGG + Intergenic
975018239 4:69452051-69452073 ATGAAGTTTTTAAGGATAGAAGG + Intergenic
975781334 4:77843498-77843520 CAGCAGTCCTTGGGGATTGAAGG - Intergenic
976564405 4:86537270-86537292 CTGAACTTTGTGGTGATAGATGG + Intronic
977854149 4:101867410-101867432 AAGAAGTTCTTTGGGAAAGAAGG + Intronic
981435676 4:144718759-144718781 GTGATTTTCTTGTGGATAGATGG + Intronic
984264498 4:177481042-177481064 CTGAGGTTGTTGGGGGTAGGGGG - Intergenic
987552635 5:19403635-19403657 CTGATGTTCCTGGGGGTGGAAGG + Intergenic
988944240 5:36179344-36179366 CTTAAGTTCTTTAGCATAGATGG - Intronic
989566471 5:42906119-42906141 TTGAAGGTCTAGGGGATAAAGGG - Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
991225829 5:64270424-64270446 CTGAAATTCCTGGGGAAGGAAGG - Intronic
992758629 5:79932393-79932415 CTGAAGTTCTTGGGGCCCCAAGG + Intergenic
992912645 5:81412333-81412355 CTGGATTACTGGGGGATAGAGGG - Intergenic
994213221 5:97108847-97108869 CAGTAGTTCTTGGTGATTGATGG + Intronic
997417240 5:133738576-133738598 CAGAAGTTCTTTGGGTCAGAAGG - Intergenic
1002669492 5:180855074-180855096 CTGAAGTATTTAGGGATAAAGGG + Intronic
1003042195 6:2698832-2698854 CTGAAGTCCTGGGTGATAAAAGG + Intronic
1003605393 6:7555452-7555474 CTGAAATATTTGGGGGTAGAAGG + Intronic
1004028567 6:11843377-11843399 GTGAAGATCTTGGGGACAGATGG - Intergenic
1004141043 6:13017468-13017490 CTGACTTTAGTGGGGATAGAGGG + Intronic
1004282349 6:14291736-14291758 CTGAGGTTCCTGAGGATGGATGG + Intergenic
1005103299 6:22197281-22197303 CTAAAGTTGTTGAGGATAGTAGG - Intergenic
1005392842 6:25350671-25350693 TTAAAGTTCTTGAGGAGAGAGGG + Intronic
1005726923 6:28658442-28658464 CAAAATTTCTTGGTGATAGAGGG - Intergenic
1006374509 6:33664403-33664425 CTGAAACTCTTGGGGGTAGATGG + Intronic
1006634159 6:35450388-35450410 CTGCAGTTCATGGGGGTGGAGGG - Intergenic
1007487633 6:42192903-42192925 CTGAAATACTTAGGGATAAACGG + Intronic
1008341043 6:50364563-50364585 GAGCTGTTCTTGGGGATAGAAGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1014350296 6:120334156-120334178 CGGAAGTTCAGGGGGAGAGAAGG + Intergenic
1015080289 6:129216769-129216791 CTTAAGTTCTTGAGAATAGTTGG + Intronic
1015527216 6:134185174-134185196 CTAAAGTTCTTGAGGAAAGTTGG - Intronic
1016449782 6:144170253-144170275 CTGAAGTTCTTGGTGCTATGTGG + Intronic
1016672079 6:146720930-146720952 CTGAAGCTCCTGTGGAAAGAAGG + Intronic
1019345253 7:526599-526621 CTGAAGCCCTTGGGGATGGGAGG - Intergenic
1020217109 7:6201733-6201755 CTCAAGTTCTTAGGGTTCGAAGG + Intronic
1021355158 7:19645017-19645039 CTGAAGTTCTTTGGAAGAAATGG - Intergenic
1022229780 7:28403269-28403291 TTGAAGTTCTGTGGGTTAGATGG - Intronic
1027936306 7:84608002-84608024 ATGAAGTGCTAGGGGAGAGAGGG - Intergenic
1030814768 7:114022592-114022614 AGGAAGTTCTTTGGGAGAGAGGG - Intronic
1031852863 7:126886786-126886808 CTGTAGTACTTGGGAATTGAGGG - Intronic
1032888264 7:136165397-136165419 CAGAAATTCTGGGGGTTAGAGGG + Intergenic
1034815190 7:154166285-154166307 GTGACGTTCTTGGGGAGGGAGGG + Intronic
1036484694 8:9169031-9169053 TTGAAGTTCTTGGGGAATGTCGG - Intergenic
1036979664 8:13456153-13456175 CTGAAGTTATTAGGGATCCATGG - Intronic
1037730895 8:21523304-21523326 CTGAACTTCTTGGGGGTGGGGGG + Intergenic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1042334081 8:67612160-67612182 CTGAAGTTTTAGGGCAGAGAGGG + Intronic
1042524969 8:69754792-69754814 CAGAAGGTCTTGGTGATATATGG - Intronic
1045104750 8:98881357-98881379 CTGGAGTTGTGGGGGAGAGATGG + Intronic
1045550753 8:103169952-103169974 CTGAGTTCCTTGGGGACAGAGGG + Intronic
1045759249 8:105584547-105584569 GTGAAGTACTAGGAGATAGAGGG - Intronic
1045799705 8:106088010-106088032 CTGAGGTTCTAGGGGTTAGGAGG + Intergenic
1046157584 8:110313191-110313213 GTGAAGTTCTTGACCATAGAAGG - Intergenic
1049985166 9:943613-943635 CTGAAGGTCATGGGGATGGTGGG + Intronic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054357354 9:64074017-64074039 ATGAAGTTTTTAAGGATAGAAGG - Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1055715521 9:79113522-79113544 CAGAAATTCATGGGGACAGAGGG - Intergenic
1055756378 9:79562950-79562972 CTGAAGTTTTGGGGGATGGAGGG - Intergenic
1056173512 9:84011595-84011617 CTGAAGTTATTTGGGACAGCTGG + Intergenic
1059504285 9:114783712-114783734 CTGAAGTTCTTAGGCATGGAGGG + Intergenic
1062708666 9:137959966-137959988 CAGAAGTTCATGGCCATAGAAGG + Intronic
1203748880 Un_GL000218v1:60824-60846 ATGAAGTTTTTAAGGATAGAAGG - Intergenic
1185856707 X:3542826-3542848 ATGAGGGTCTTGGGGAGAGAGGG + Intergenic
1186539160 X:10382609-10382631 CTGTAGCCCTTGGGGATGGAGGG + Intergenic
1186716211 X:12254730-12254752 CTGAAGTTCTGGGGGATTGGAGG + Intronic
1187954274 X:24500658-24500680 CTGATGTTCTTGGTGAAGGAAGG + Intronic
1189482938 X:41407014-41407036 CTGAAGCAGTTGGGGACAGAGGG - Intergenic
1190406591 X:50094029-50094051 CTGAAGTGTTTGGGGGTAGAGGG - Exonic
1190546273 X:51531113-51531135 CTGAAGTTTGTAGGGAAAGAGGG - Intergenic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1191923385 X:66281063-66281085 CTGAAGTTCTAGAGGCTAGAGGG + Intergenic
1192002111 X:67163427-67163449 CTCAAGTAACTGGGGATAGAGGG + Intergenic
1192343740 X:70284289-70284311 GTGAAGTCCTTGTGGAAAGAAGG - Exonic
1192571172 X:72206758-72206780 CTGCAGTCTTTGGGGATAGCTGG - Exonic
1192800032 X:74457031-74457053 CTGAAATTGGTGGAGATAGAAGG - Intronic
1192829417 X:74735648-74735670 CTGAAGTCCTTGGTGCTAGCTGG - Exonic
1192859274 X:75048472-75048494 CTGAAGATGATGGGGATAGGTGG - Intergenic
1193726171 X:85041706-85041728 CTGGAGGCCTTGGGAATAGAGGG + Intronic
1195113109 X:101666968-101666990 CTTGGGCTCTTGGGGATAGAAGG + Intergenic
1195663511 X:107406096-107406118 ATGATGTTCTTGGGGCTGGATGG - Intergenic
1196087787 X:111704667-111704689 CTGGGGTTGGTGGGGATAGAGGG + Intronic
1198134842 X:133738661-133738683 CTGAAATCCCTGGGAATAGAGGG - Intronic
1198338678 X:135692902-135692924 AAGAGTTTCTTGGGGATAGAAGG + Intergenic
1199942418 X:152638659-152638681 CTTAAATCCTTGGGGATGGATGG - Intronic
1200807468 Y:7447296-7447318 ATGAGGGTCTTGGGGAGAGAGGG - Intergenic
1201162241 Y:11175827-11175849 ATGAAGTTTTTAAGGATAGAAGG - Intergenic