ID: 1191204860

View in Genome Browser
Species Human (GRCh38)
Location X:57822866-57822888
Sequence TCTGATTTGCATAGGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191204849_1191204860 30 Left 1191204849 X:57822813-57822835 CCATGTGCAGTGGAAAAGCAGTT No data
Right 1191204860 X:57822866-57822888 TCTGATTTGCATAGGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191204860 Original CRISPR TCTGATTTGCATAGGGTCCA GGG Intergenic
No off target data available for this crispr