ID: 1191208599

View in Genome Browser
Species Human (GRCh38)
Location X:57860817-57860839
Sequence ATGAGTTCATGAGCTTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191208596_1191208599 3 Left 1191208596 X:57860791-57860813 CCATGGAATACTACACAGCCATA 0: 612
1: 2820
2: 28090
3: 15197
4: 7235
Right 1191208599 X:57860817-57860839 ATGAGTTCATGAGCTTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191208599 Original CRISPR ATGAGTTCATGAGCTTTGCA GGG Intergenic
No off target data available for this crispr