ID: 1191210373

View in Genome Browser
Species Human (GRCh38)
Location X:57878223-57878245
Sequence GCATAGATGTGTGCAGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191210373_1191210377 23 Left 1191210373 X:57878223-57878245 CCTGTTGCTGCACACATCTATGC No data
Right 1191210377 X:57878269-57878291 TGATGCAGAAAACAAAAAATGGG No data
1191210373_1191210378 24 Left 1191210373 X:57878223-57878245 CCTGTTGCTGCACACATCTATGC No data
Right 1191210378 X:57878270-57878292 GATGCAGAAAACAAAAAATGGGG No data
1191210373_1191210376 22 Left 1191210373 X:57878223-57878245 CCTGTTGCTGCACACATCTATGC No data
Right 1191210376 X:57878268-57878290 CTGATGCAGAAAACAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191210373 Original CRISPR GCATAGATGTGTGCAGCAAC AGG (reversed) Intergenic
No off target data available for this crispr