ID: 1191213186

View in Genome Browser
Species Human (GRCh38)
Location X:57910005-57910027
Sequence CCCGCGGGCTGCTCTGCGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191213186_1191213192 2 Left 1191213186 X:57910005-57910027 CCCTGCGCAGAGCAGCCCGCGGG 0: 1
1: 0
2: 2
3: 19
4: 171
Right 1191213192 X:57910030-57910052 TCGCGCCGCTCTCGTCCCCCTGG 0: 1
1: 1
2: 0
3: 7
4: 56
1191213186_1191213194 10 Left 1191213186 X:57910005-57910027 CCCTGCGCAGAGCAGCCCGCGGG 0: 1
1: 0
2: 2
3: 19
4: 171
Right 1191213194 X:57910038-57910060 CTCTCGTCCCCCTGGAGCCCCGG 0: 1
1: 1
2: 1
3: 14
4: 262
1191213186_1191213200 21 Left 1191213186 X:57910005-57910027 CCCTGCGCAGAGCAGCCCGCGGG 0: 1
1: 0
2: 2
3: 19
4: 171
Right 1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG 0: 1
1: 1
2: 2
3: 39
4: 395
1191213186_1191213195 11 Left 1191213186 X:57910005-57910027 CCCTGCGCAGAGCAGCCCGCGGG 0: 1
1: 0
2: 2
3: 19
4: 171
Right 1191213195 X:57910039-57910061 TCTCGTCCCCCTGGAGCCCCGGG 0: 1
1: 1
2: 2
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191213186 Original CRISPR CCCGCGGGCTGCTCTGCGCA GGG (reversed) Exonic