ID: 1191213190

View in Genome Browser
Species Human (GRCh38)
Location X:57910020-57910042
Sequence GAGAGCGGCGCGAACCCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2377
Summary {0: 1, 1: 1, 2: 0, 3: 61, 4: 2314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191213190_1191213207 25 Left 1191213190 X:57910020-57910042 CCCGCGGGGTTCGCGCCGCTCTC 0: 1
1: 1
2: 0
3: 61
4: 2314
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266
1191213190_1191213200 6 Left 1191213190 X:57910020-57910042 CCCGCGGGGTTCGCGCCGCTCTC 0: 1
1: 1
2: 0
3: 61
4: 2314
Right 1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG 0: 1
1: 1
2: 2
3: 39
4: 395
1191213190_1191213194 -5 Left 1191213190 X:57910020-57910042 CCCGCGGGGTTCGCGCCGCTCTC 0: 1
1: 1
2: 0
3: 61
4: 2314
Right 1191213194 X:57910038-57910060 CTCTCGTCCCCCTGGAGCCCCGG 0: 1
1: 1
2: 1
3: 14
4: 262
1191213190_1191213195 -4 Left 1191213190 X:57910020-57910042 CCCGCGGGGTTCGCGCCGCTCTC 0: 1
1: 1
2: 0
3: 61
4: 2314
Right 1191213195 X:57910039-57910061 TCTCGTCCCCCTGGAGCCCCGGG 0: 1
1: 1
2: 2
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191213190 Original CRISPR GAGAGCGGCGCGAACCCCGC GGG (reversed) Exonic