ID: 1191213191

View in Genome Browser
Species Human (GRCh38)
Location X:57910021-57910043
Sequence CGAGAGCGGCGCGAACCCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 400}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191213191_1191213195 -5 Left 1191213191 X:57910021-57910043 CCGCGGGGTTCGCGCCGCTCTCG 0: 1
1: 1
2: 0
3: 9
4: 400
Right 1191213195 X:57910039-57910061 TCTCGTCCCCCTGGAGCCCCGGG 0: 1
1: 1
2: 2
3: 22
4: 254
1191213191_1191213194 -6 Left 1191213191 X:57910021-57910043 CCGCGGGGTTCGCGCCGCTCTCG 0: 1
1: 1
2: 0
3: 9
4: 400
Right 1191213194 X:57910038-57910060 CTCTCGTCCCCCTGGAGCCCCGG 0: 1
1: 1
2: 1
3: 14
4: 262
1191213191_1191213200 5 Left 1191213191 X:57910021-57910043 CCGCGGGGTTCGCGCCGCTCTCG 0: 1
1: 1
2: 0
3: 9
4: 400
Right 1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG 0: 1
1: 1
2: 2
3: 39
4: 395
1191213191_1191213207 24 Left 1191213191 X:57910021-57910043 CCGCGGGGTTCGCGCCGCTCTCG 0: 1
1: 1
2: 0
3: 9
4: 400
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191213191 Original CRISPR CGAGAGCGGCGCGAACCCCG CGG (reversed) Exonic