ID: 1191213195

View in Genome Browser
Species Human (GRCh38)
Location X:57910039-57910061
Sequence TCTCGTCCCCCTGGAGCCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191213188_1191213195 10 Left 1191213188 X:57910006-57910028 CCTGCGCAGAGCAGCCCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1191213195 X:57910039-57910061 TCTCGTCCCCCTGGAGCCCCGGG 0: 1
1: 1
2: 2
3: 22
4: 254
1191213186_1191213195 11 Left 1191213186 X:57910005-57910027 CCCTGCGCAGAGCAGCCCGCGGG 0: 1
1: 0
2: 2
3: 19
4: 171
Right 1191213195 X:57910039-57910061 TCTCGTCCCCCTGGAGCCCCGGG 0: 1
1: 1
2: 2
3: 22
4: 254
1191213191_1191213195 -5 Left 1191213191 X:57910021-57910043 CCGCGGGGTTCGCGCCGCTCTCG 0: 1
1: 1
2: 0
3: 9
4: 400
Right 1191213195 X:57910039-57910061 TCTCGTCCCCCTGGAGCCCCGGG 0: 1
1: 1
2: 2
3: 22
4: 254
1191213190_1191213195 -4 Left 1191213190 X:57910020-57910042 CCCGCGGGGTTCGCGCCGCTCTC 0: 1
1: 1
2: 0
3: 61
4: 2314
Right 1191213195 X:57910039-57910061 TCTCGTCCCCCTGGAGCCCCGGG 0: 1
1: 1
2: 2
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191213195 Original CRISPR TCTCGTCCCCCTGGAGCCCC GGG Exonic