ID: 1191213200

View in Genome Browser
Species Human (GRCh38)
Location X:57910049-57910071
Sequence CTGGAGCCCCGGGCCCGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 395}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191213186_1191213200 21 Left 1191213186 X:57910005-57910027 CCCTGCGCAGAGCAGCCCGCGGG 0: 1
1: 0
2: 2
3: 19
4: 171
Right 1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG 0: 1
1: 1
2: 2
3: 39
4: 395
1191213188_1191213200 20 Left 1191213188 X:57910006-57910028 CCTGCGCAGAGCAGCCCGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG 0: 1
1: 1
2: 2
3: 39
4: 395
1191213193_1191213200 -9 Left 1191213193 X:57910035-57910057 CCGCTCTCGTCCCCCTGGAGCCC 0: 1
1: 1
2: 0
3: 35
4: 374
Right 1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG 0: 1
1: 1
2: 2
3: 39
4: 395
1191213191_1191213200 5 Left 1191213191 X:57910021-57910043 CCGCGGGGTTCGCGCCGCTCTCG 0: 1
1: 1
2: 0
3: 9
4: 400
Right 1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG 0: 1
1: 1
2: 2
3: 39
4: 395
1191213190_1191213200 6 Left 1191213190 X:57910020-57910042 CCCGCGGGGTTCGCGCCGCTCTC 0: 1
1: 1
2: 0
3: 61
4: 2314
Right 1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG 0: 1
1: 1
2: 2
3: 39
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191213200 Original CRISPR CTGGAGCCCCGGGCCCGCCT TGG Exonic