ID: 1191213207

View in Genome Browser
Species Human (GRCh38)
Location X:57910068-57910090
Sequence TTGGCCTCCTCCCTCAACAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 266}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191213191_1191213207 24 Left 1191213191 X:57910021-57910043 CCGCGGGGTTCGCGCCGCTCTCG 0: 1
1: 1
2: 0
3: 9
4: 400
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266
1191213199_1191213207 -3 Left 1191213199 X:57910048-57910070 CCTGGAGCCCCGGGCCCGCCTTG 0: 1
1: 0
2: 2
3: 38
4: 389
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266
1191213190_1191213207 25 Left 1191213190 X:57910020-57910042 CCCGCGGGGTTCGCGCCGCTCTC 0: 1
1: 1
2: 0
3: 61
4: 2314
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266
1191213196_1191213207 0 Left 1191213196 X:57910045-57910067 CCCCCTGGAGCCCCGGGCCCGCC 0: 1
1: 1
2: 4
3: 52
4: 575
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266
1191213201_1191213207 -10 Left 1191213201 X:57910055-57910077 CCCCGGGCCCGCCTTGGCCTCCT 0: 1
1: 0
2: 8
3: 77
4: 562
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266
1191213193_1191213207 10 Left 1191213193 X:57910035-57910057 CCGCTCTCGTCCCCCTGGAGCCC 0: 1
1: 1
2: 0
3: 35
4: 374
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266
1191213198_1191213207 -2 Left 1191213198 X:57910047-57910069 CCCTGGAGCCCCGGGCCCGCCTT 0: 1
1: 0
2: 2
3: 20
4: 246
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266
1191213197_1191213207 -1 Left 1191213197 X:57910046-57910068 CCCCTGGAGCCCCGGGCCCGCCT 0: 1
1: 1
2: 4
3: 48
4: 327
Right 1191213207 X:57910068-57910090 TTGGCCTCCTCCCTCAACACAGG 0: 1
1: 1
2: 0
3: 23
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191213207 Original CRISPR TTGGCCTCCTCCCTCAACAC AGG Exonic