ID: 1191214487

View in Genome Browser
Species Human (GRCh38)
Location X:57920998-57921020
Sequence TAGGGTATTATAGTGTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191214487_1191214496 26 Left 1191214487 X:57920998-57921020 CCTGCTAACACTATAATACCCTA No data
Right 1191214496 X:57921047-57921069 CCACTCAGGCTGCCCCTCCTGGG No data
1191214487_1191214493 12 Left 1191214487 X:57920998-57921020 CCTGCTAACACTATAATACCCTA No data
Right 1191214493 X:57921033-57921055 CAAAGTTACTATCACCACTCAGG No data
1191214487_1191214494 25 Left 1191214487 X:57920998-57921020 CCTGCTAACACTATAATACCCTA No data
Right 1191214494 X:57921046-57921068 ACCACTCAGGCTGCCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191214487 Original CRISPR TAGGGTATTATAGTGTTAGC AGG (reversed) Intergenic
No off target data available for this crispr