ID: 1191217771

View in Genome Browser
Species Human (GRCh38)
Location X:57951389-57951411
Sequence GGCCAGAAGCCTTGTTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191217771_1191217783 26 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217783 X:57951438-57951460 CTGGCTATCAGTGGTGGGGGTGG No data
1191217771_1191217779 21 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217779 X:57951433-57951455 TCTGCCTGGCTATCAGTGGTGGG No data
1191217771_1191217777 17 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217777 X:57951429-57951451 ATTATCTGCCTGGCTATCAGTGG No data
1191217771_1191217785 30 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217785 X:57951442-57951464 CTATCAGTGGTGGGGGTGGGTGG No data
1191217771_1191217776 7 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217776 X:57951419-57951441 TCTAGCAGGTATTATCTGCCTGG No data
1191217771_1191217781 23 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217781 X:57951435-57951457 TGCCTGGCTATCAGTGGTGGGGG No data
1191217771_1191217780 22 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217780 X:57951434-57951456 CTGCCTGGCTATCAGTGGTGGGG No data
1191217771_1191217778 20 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217778 X:57951432-57951454 ATCTGCCTGGCTATCAGTGGTGG No data
1191217771_1191217774 -7 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217774 X:57951405-57951427 TCTGGCCTAGATAGTCTAGCAGG No data
1191217771_1191217784 27 Left 1191217771 X:57951389-57951411 CCCACCAAACAAGGCTTCTGGCC No data
Right 1191217784 X:57951439-57951461 TGGCTATCAGTGGTGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191217771 Original CRISPR GGCCAGAAGCCTTGTTTGGT GGG (reversed) Intergenic
No off target data available for this crispr