ID: 1191218968

View in Genome Browser
Species Human (GRCh38)
Location X:57965360-57965382
Sequence GGACTGAGAGGAGCACAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191218964_1191218968 -8 Left 1191218964 X:57965345-57965367 CCTGTGGTGGGGTGGGGACTGAG No data
Right 1191218968 X:57965360-57965382 GGACTGAGAGGAGCACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191218968 Original CRISPR GGACTGAGAGGAGCACAGGG AGG Intergenic
No off target data available for this crispr