ID: 1191219881

View in Genome Browser
Species Human (GRCh38)
Location X:57976797-57976819
Sequence AATTTTGCACACACATGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191219878_1191219881 9 Left 1191219878 X:57976765-57976787 CCAAGCGTCTTTATGAGAGAGAA No data
Right 1191219881 X:57976797-57976819 AATTTTGCACACACATGCAGAGG No data
1191219876_1191219881 14 Left 1191219876 X:57976760-57976782 CCATCCCAAGCGTCTTTATGAGA No data
Right 1191219881 X:57976797-57976819 AATTTTGCACACACATGCAGAGG No data
1191219875_1191219881 22 Left 1191219875 X:57976752-57976774 CCTGAATGCCATCCCAAGCGTCT No data
Right 1191219881 X:57976797-57976819 AATTTTGCACACACATGCAGAGG No data
1191219877_1191219881 10 Left 1191219877 X:57976764-57976786 CCCAAGCGTCTTTATGAGAGAGA No data
Right 1191219881 X:57976797-57976819 AATTTTGCACACACATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191219881 Original CRISPR AATTTTGCACACACATGCAG AGG Intergenic
No off target data available for this crispr