ID: 1191220060

View in Genome Browser
Species Human (GRCh38)
Location X:57978319-57978341
Sequence AATAAAGCACAGAAGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191220060_1191220062 1 Left 1191220060 X:57978319-57978341 CCCAGATGCTTCTGTGCTTTATT No data
Right 1191220062 X:57978343-57978365 TAGCACGTACCCACCTGTTAAGG No data
1191220060_1191220063 6 Left 1191220060 X:57978319-57978341 CCCAGATGCTTCTGTGCTTTATT No data
Right 1191220063 X:57978348-57978370 CGTACCCACCTGTTAAGGTATGG No data
1191220060_1191220065 8 Left 1191220060 X:57978319-57978341 CCCAGATGCTTCTGTGCTTTATT No data
Right 1191220065 X:57978350-57978372 TACCCACCTGTTAAGGTATGGGG No data
1191220060_1191220064 7 Left 1191220060 X:57978319-57978341 CCCAGATGCTTCTGTGCTTTATT No data
Right 1191220064 X:57978349-57978371 GTACCCACCTGTTAAGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191220060 Original CRISPR AATAAAGCACAGAAGCATCT GGG (reversed) Intergenic
No off target data available for this crispr