ID: 1191220765

View in Genome Browser
Species Human (GRCh38)
Location X:57985727-57985749
Sequence CAGCTGGGAAAGCTTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191220765_1191220776 11 Left 1191220765 X:57985727-57985749 CCAATGCCAAGCTTTCCCAGCTG 0: 1
1: 0
2: 3
3: 29
4: 233
Right 1191220776 X:57985761-57985783 GCAGCGGGCCAAGCAGGACATGG 0: 13
1: 9
2: 21
3: 34
4: 222
1191220765_1191220773 5 Left 1191220765 X:57985727-57985749 CCAATGCCAAGCTTTCCCAGCTG 0: 1
1: 0
2: 3
3: 29
4: 233
Right 1191220773 X:57985755-57985777 TGCCCTGCAGCGGGCCAAGCAGG No data
1191220765_1191220772 -4 Left 1191220765 X:57985727-57985749 CCAATGCCAAGCTTTCCCAGCTG 0: 1
1: 0
2: 3
3: 29
4: 233
Right 1191220772 X:57985746-57985768 GCTGGAGGCTGCCCTGCAGCGGG No data
1191220765_1191220771 -5 Left 1191220765 X:57985727-57985749 CCAATGCCAAGCTTTCCCAGCTG 0: 1
1: 0
2: 3
3: 29
4: 233
Right 1191220771 X:57985745-57985767 AGCTGGAGGCTGCCCTGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191220765 Original CRISPR CAGCTGGGAAAGCTTGGCAT TGG (reversed) Intergenic
900608896 1:3536184-3536206 CAGCTGGGGAGGCTTTGCAGAGG - Intronic
901102378 1:6728734-6728756 CACCAGGGAAAGCATGGCCTTGG + Intergenic
901301042 1:8200345-8200367 CAGCTGGGACAGGTTGGAAAGGG + Intergenic
901617430 1:10552966-10552988 CAGCTTGGAAAGGTGGGCAAAGG + Intronic
902089858 1:13894323-13894345 CAGAAGGGAAAGATTGGCATGGG + Intergenic
904581507 1:31547483-31547505 CACGTGGGAATGATTGGCATTGG + Intergenic
905662350 1:39737310-39737332 CAGGTGGGAAAGGTAGGCAGAGG - Intronic
905688519 1:39926167-39926189 CAGCTGTGAATCCTTGGCTTGGG - Intergenic
905954494 1:41981027-41981049 CAGCTGGGCAAGCTTGAGAGAGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
907241309 1:53082531-53082553 GGGCTGGGGAAGCTTGCCATGGG + Intronic
907431348 1:54413938-54413960 CAGCTGGCCAAGCTTGGCACTGG + Intergenic
908698831 1:66875583-66875605 CAGCTGGGAGAGTTTGGAATTGG + Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
913198223 1:116475481-116475503 CAGCTGGGGAAGCTATTCATAGG + Intergenic
913517681 1:119618313-119618335 CAGCTGGGAATGCTCAGCTTTGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
916205755 1:162314860-162314882 AAGCTGGGAAGGTTTAGCATTGG + Intronic
917365327 1:174225341-174225363 CAACTGGGACATCTTGGGATTGG + Intronic
918458243 1:184748796-184748818 TAGTTGGGAAAGTTTGGCAGAGG - Intronic
918890329 1:190258139-190258161 CAGCTGGGGAAGCTTGAACTGGG - Intronic
918951606 1:191146906-191146928 CAGCTGAGAAAGCTCTTCATTGG - Intergenic
919391579 1:196992043-196992065 CAGCTGGAAAAGCTTGAACTGGG - Intronic
919923501 1:202180050-202180072 AGGCTGGGCAAGCTTGGCAGAGG - Intergenic
920151821 1:203915802-203915824 CAGCTGCAAAATCATGGCATTGG + Intergenic
920715413 1:208335831-208335853 CAGCTAGGAAAGCTTTGTTTTGG - Intergenic
920914330 1:210247893-210247915 TAGCTGTGCAAGCTTGGCCTTGG + Intergenic
921004147 1:211076071-211076093 CAGCTGGGGAAGCTTGAACTGGG + Intronic
923270206 1:232348406-232348428 CAGCTGGGACGTCTTGGCAATGG + Intergenic
924435263 1:244034005-244034027 AAGCTGGGAAAGCTTTACTTGGG + Intergenic
924611846 1:245580039-245580061 CAGCTGGAAAAACATGGCAGAGG - Intronic
1063598655 10:7460675-7460697 CAAGTGGGAAAACTTGGCTTCGG + Intergenic
1066678913 10:37917311-37917333 CGGAAGGGAAAGCTTGGCCTGGG + Intergenic
1067853519 10:49770092-49770114 GGGCTGGGACAGCTTGGCTTTGG + Intergenic
1068137814 10:52967653-52967675 CAGTTGGGAAGGCCTGGAATGGG + Intergenic
1069540662 10:69291551-69291573 CAGCTGTACAAGCTTGGCAAAGG - Intronic
1070574129 10:77664623-77664645 CAGCTGGGAAATCTGGGGAGAGG - Intergenic
1070691725 10:78532083-78532105 AGGCTGAGAAACCTTGGCATAGG + Intergenic
1070711330 10:78685321-78685343 CTGCAGGGAAAGCTTGCCCTGGG - Intergenic
1072379985 10:94858179-94858201 CAGCTGGGAAAGCTTGAACTGGG - Intergenic
1074500215 10:114017010-114017032 CATCTGGAAAAGCCTGGGATTGG - Intergenic
1074762125 10:116675021-116675043 CAGCTGGGAGGGCTTGGCCGGGG + Exonic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1076475810 10:130750693-130750715 CAGCTGGGAAGGGTTGGCTATGG - Intergenic
1076826784 10:132973371-132973393 CAGCTGGGCAGGCTGGGCAGGGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077846857 11:6034410-6034432 CAGTTGGGAAAACATGGCTTGGG + Intergenic
1079928571 11:26527904-26527926 CAGCTGTGAAAGCAGGGCATGGG - Intronic
1081716533 11:45254498-45254520 CAGCTGGGAAGACTTGGGTTTGG - Intronic
1081961772 11:47143128-47143150 CAGTGGGGAAAGCATGGCATTGG - Intronic
1083673547 11:64313401-64313423 CGGCTGGGGAAGATTGCCATGGG + Intronic
1084098948 11:66932672-66932694 CAGCTGGAGAAGCTAGCCATCGG + Intronic
1085291599 11:75404213-75404235 CAGCTGAGAGTGCTTGGCAAAGG + Intronic
1088555876 11:111060004-111060026 CAGCTGGGAAAGCAGATCATTGG + Intergenic
1089258015 11:117204258-117204280 CAGGAGGGAAAGCATGTCATTGG + Exonic
1090383666 11:126344240-126344262 CAGCAGGGGAAGCTGGGTATGGG - Intronic
1090785988 11:130047971-130047993 CAGCTGGGATAGATTGCCAGTGG + Intergenic
1091329141 11:134716980-134717002 CATCTGGGGAAGGTTGGCAGGGG - Intergenic
1092072160 12:5640167-5640189 CAGTTGGGAATGCTTTTCATGGG - Intronic
1092962480 12:13609429-13609451 CAGTTGGGAAGTGTTGGCATCGG - Intronic
1096146922 12:49284853-49284875 AAGGTGGGAAAGCTGGGCAGAGG - Intergenic
1096470246 12:51871194-51871216 CACCAGGGAAAGCTCAGCATGGG + Intergenic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1096757078 12:53808610-53808632 CAGCTGGGAAAACTTGGAGCCGG + Intergenic
1098050282 12:66445823-66445845 CAGCTGGGGAACCTTGGGGTAGG + Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1098364172 12:69685119-69685141 CAGCTGGAAAAGCCTGAAATAGG + Intronic
1100616998 12:96238502-96238524 CAGCCGGGGGAGCTTGGCAGTGG + Intronic
1104409702 12:128547829-128547851 CAGATGGGAATGGTTGGCAGGGG - Intronic
1105943797 13:25172568-25172590 GAGCAGGAAAAGCTTGGCAGGGG + Intergenic
1105986371 13:25571201-25571223 CTGCTGGGGAAGCTGTGCATGGG + Intronic
1114083399 14:19220120-19220142 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1114159246 14:20144515-20144537 CAGCTGGGAAAGCCTGGAAGGGG - Exonic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1118763764 14:68896394-68896416 CAGCTGGGAAGGCCAGGCTTAGG + Intronic
1118837721 14:69488346-69488368 GCTCTGGGAAAGCTCGGCATTGG - Intronic
1119703571 14:76770700-76770722 GAGATGGGAGAGCTAGGCATGGG + Intronic
1119756160 14:77121187-77121209 CAGATGGGAGCGCTTGGCATGGG + Intronic
1120549027 14:85846531-85846553 CAGGTGAGAGAGCTTGGTATGGG - Intergenic
1121124238 14:91395695-91395717 CAGCTGGGCAATCCTGGCCTGGG - Intronic
1202895013 14_GL000194v1_random:1889-1911 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1123466519 15:20520345-20520367 AGGCTGGGATAGCTTGGCACTGG + Intergenic
1123651595 15:22480692-22480714 AGGCTGGGATAGCTTGGCACTGG - Intergenic
1123742016 15:23289556-23289578 AGGCTGGGATAGCTTGGCACTGG - Intergenic
1123744980 15:23313002-23313024 AGGCTGGGATAGCTTGGCACTGG + Intergenic
1123761308 15:23434929-23434951 AGGCTGGGATAGCTTGGCACTGG + Intergenic
1124267989 15:28254599-28254621 AGGCTGGGATAGCTTGGCACTGG - Intronic
1124277250 15:28336324-28336346 AGGCTGGGATAGCTTGGCACTGG + Intergenic
1124305451 15:28575282-28575304 AGGCTGGGATAGCTTGGCACTGG - Intergenic
1124458982 15:29871525-29871547 CCTCTGGGAAAGCTTGCCGTGGG + Intronic
1124874626 15:33580410-33580432 CAGCTGTGAGAGCATGACATTGG + Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126102692 15:45129424-45129446 CTGCTGGGATTGCTGGGCATGGG - Intronic
1127284011 15:57517002-57517024 CAGCTGCCAAAGCTGGGCCTGGG - Intronic
1128300977 15:66566077-66566099 CAGCTGGGGGAGCTTGGCGCTGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130907173 15:88249032-88249054 CTGCTGGGAAAACTGGGCTTAGG + Intronic
1132409325 15:101564827-101564849 GGGCTGGGCAAGCTTGGCCTGGG - Intergenic
1132887399 16:2188681-2188703 CAGCTGGGAAGTCTTAGCACAGG - Intronic
1133522979 16:6576803-6576825 CAGCTGTGAAATCTTTGCCTTGG - Intronic
1133988256 16:10684780-10684802 CAGCAGGGTGAGCTTGGCATTGG - Intronic
1136236871 16:28919775-28919797 CAGATGGAAAAGGTTGGGATTGG - Exonic
1137027472 16:35492356-35492378 CTGCTGCCGAAGCTTGGCATTGG + Intergenic
1137726718 16:50661617-50661639 CAGCTAGAAAAACTTGGCTTTGG + Intergenic
1137750833 16:50859963-50859985 CAAATGGAAAATCTTGGCATTGG + Intergenic
1139200312 16:64969306-64969328 CAGCAGGGAAAGCTTAGTAAAGG + Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141679356 16:85535376-85535398 CAGATGGGAAACCCTGGCCTCGG + Intergenic
1142635838 17:1256999-1257021 CAGCCGGGGAAGCTTGGCGAGGG - Intergenic
1142904912 17:3034901-3034923 CAGCTGGAAATCCTTGTCATTGG - Exonic
1143091740 17:4452964-4452986 CAGCTGGGTGAGCTTAGCATAGG - Intronic
1143153682 17:4822659-4822681 CCGCAGGGAACGCGTGGCATTGG - Exonic
1144299043 17:13906001-13906023 CACCTGGGAAAGCTGGGAAGAGG - Intergenic
1144391256 17:14795504-14795526 CAGCTGAGAAGGCTTGGAAAGGG + Intergenic
1144657876 17:17049568-17049590 CAGGTGGGAAAGAGTGGCTTGGG - Intronic
1144658177 17:17051412-17051434 CAGCTGAGAAAGAGTGGCTTGGG - Intronic
1146636925 17:34513421-34513443 CAGCTGGGAAAGGGTGGGAATGG - Intergenic
1148441256 17:47712777-47712799 CAGCTGGGAAGTCTTCCCATGGG - Intergenic
1148791474 17:50175618-50175640 CAACTGCGAGTGCTTGGCATTGG - Intronic
1148818012 17:50344946-50344968 CAGCTGGGGAAGCCAGGCACTGG - Intergenic
1148861108 17:50604732-50604754 CTGCTGGGGAAACTTGGCCTTGG + Intronic
1151184166 17:72351150-72351172 CCTCTGGGACAGCATGGCATGGG + Intergenic
1151819794 17:76491291-76491313 CAGCTGGGATGGCCTGGCCTTGG - Intronic
1151882338 17:76903189-76903211 AAGGTGGGAAAGCCTGGCAGCGG + Intronic
1153994011 18:10423904-10423926 CATCTGGGTAATCCTGGCATTGG + Intergenic
1154500082 18:14991783-14991805 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1156263548 18:35466721-35466743 CAGCAGGGAGAGCCTGGCAGGGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
1162909533 19:13841790-13841812 CAGCTGGGGAAGGTTGGGAAGGG + Intergenic
1167502269 19:49854928-49854950 CAGCTGGGTCAGCCAGGCATGGG - Intronic
1167528552 19:50000687-50000709 CAGCTGGGAGAGCTCGGCCGGGG - Intronic
925098629 2:1227636-1227658 CAGCTGGGGAAGCTGAGCTTGGG + Intronic
926561069 2:14418014-14418036 AAGGTGGGAAAGCTTGGCCTTGG + Intergenic
926988919 2:18655735-18655757 CAGGTGTCAAAGCTTTGCATGGG + Intergenic
928208543 2:29305602-29305624 AAGCTGGGTATACTTGGCATGGG - Intronic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
929628038 2:43430588-43430610 CAGTTGTGGAAACTTGGCATTGG - Intronic
931257162 2:60583735-60583757 CGGCTGGGAAAGCATGGCTTTGG + Intergenic
931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG + Intergenic
931622340 2:64223537-64223559 TAGCTGTGTAAGCTTGGCCTGGG - Intergenic
933091727 2:78127743-78127765 CAGCTGGGAATGGTTGGTGTAGG - Intergenic
934110420 2:88736994-88737016 CAGCTGTGAAACCCTGGCTTTGG + Intronic
934573466 2:95385801-95385823 CAGCTGGGAGGGCTGGGCAGCGG - Exonic
936108795 2:109648161-109648183 CGGGTGGGAATGCTTGGCGTGGG + Intergenic
936892951 2:117393348-117393370 CACCTCTGAAAGCTAGGCATGGG + Intergenic
940013839 2:149082832-149082854 CAGCTGGAAAAGCTTGTCAGCGG + Intronic
940972113 2:159905667-159905689 CAACTGTGAAACCTTGGCAGTGG - Intergenic
942484403 2:176424029-176424051 CAGCTGGGAAAACATGGAAAAGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
944706170 2:202291143-202291165 CAACTCAGAAAGCTTGGCAGAGG - Exonic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945006412 2:205412105-205412127 TAGCTGGGAAAGAGTGGAATGGG - Intronic
1169951948 20:11054723-11054745 GAGCTGGGAAAGCTTGAGTTCGG + Intergenic
1170774371 20:19362992-19363014 TCGCTGGGAAAGCTTGACTTAGG + Intronic
1170874769 20:20240274-20240296 CAGCTTGGGAAGCTTGGCTAGGG + Intronic
1171225927 20:23442179-23442201 TAGCTGGGTGATCTTGGCATGGG + Intronic
1172906516 20:38374115-38374137 CAGCTGGGAAAGTCTGGCCAGGG + Intronic
1175788397 20:61726097-61726119 CAGTGGGGAGAGCATGGCATGGG + Intronic
1175869357 20:62200911-62200933 GAGCTGGGACAGATTGGCTTGGG - Exonic
1175948701 20:62570920-62570942 CAGCTGTAAGTGCTTGGCATTGG - Intergenic
1176614716 21:9017876-9017898 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1176710495 21:10145995-10146017 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1176852999 21:13936198-13936220 CAGATGGGACAGCCTGGCAGAGG + Intergenic
1178279986 21:31273759-31273781 CATCTGGGCAACCTTGGGATTGG - Intronic
1178488880 21:33035406-33035428 CAGCTGGCAGAGCTTGGCCAAGG - Intergenic
1179433636 21:41344489-41344511 CAGCTGGGAAATGTTGCCAGAGG + Exonic
1180294576 22:10873147-10873169 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1180497382 22:15902561-15902583 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1183007303 22:34914075-34914097 CAGCTGGGAAGTCCAGGCATAGG - Intergenic
1184788962 22:46687491-46687513 CAGGTGGGAAATCTGGGCATCGG + Intronic
949103473 3:174758-174780 CAGCAGAGAAAGCATGGCAGTGG - Intergenic
952039320 3:29242454-29242476 CAGAACGGAAAGCTTGACATGGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953295945 3:41716715-41716737 CTGCTGGAAAAGCATGGAATGGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
961325080 3:126104925-126104947 CTGATGGGCAAGCTTGGCAAGGG - Intronic
961466712 3:127086132-127086154 CAGATGGGCATGCTTGGCCTTGG + Intergenic
961911218 3:130318434-130318456 CATCTGGGAAAACTTGACCTTGG + Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963646580 3:147922535-147922557 CAGCTGGGAAAGATTCAGATGGG - Intergenic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
966529743 3:180962925-180962947 CAGCTGCGACAGATTGGTATGGG + Exonic
967224271 3:187275905-187275927 CAGCTTGTAAAGCCTGCCATTGG + Intronic
967545450 3:190721410-190721432 CAGCTAAGAAAGCTTGGCTAAGG + Intergenic
967988409 3:195113321-195113343 GAGTTGGGAAAGCTTGGGAGGGG + Intronic
973254502 4:48095641-48095663 CAGCTGGGCAAGCAGGGCGTGGG + Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
986059395 5:4173763-4173785 CTCCTGGGAAAGCTGGGGATTGG + Intergenic
986165727 5:5270106-5270128 CAGGCAGGAAAGCATGGCATTGG - Intronic
988217288 5:28291592-28291614 CAGCTGGGGAAGCGGGGCTTAGG - Intergenic
989519257 5:42381778-42381800 CAGCTGGGAAACCCTGGTAGTGG + Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
992110330 5:73486743-73486765 CAGCTGGGGAAGCTTTCAATGGG - Intergenic
992757941 5:79926595-79926617 CTTCTGGGAATGCATGGCATAGG - Intergenic
996676436 5:126180354-126180376 TAGCGGGGAAAGTTTGGGATAGG - Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999155686 5:149455988-149456010 CAGCTGGAGTAGCTTGGCAGCGG - Intergenic
1003924517 6:10864339-10864361 CAGCTGGAAGAGCTGGGCAGAGG - Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1006861588 6:37175022-37175044 CAGCTATGGAAGCTTGGAATAGG - Exonic
1007249753 6:40487787-40487809 CAGCTGGGAAGGGTGGGCAGCGG - Intronic
1007925146 6:45644254-45644276 CAGCTGGGAAAGCACAGCTTGGG - Intronic
1008045672 6:46849211-46849233 CTGTCGGGAATGCTTGGCATAGG + Intergenic
1008572018 6:52825470-52825492 CAGATGGGGCAGCTTGGCAGAGG - Intergenic
1008675476 6:53813479-53813501 CAGCTGGTAAAGTTGGGCAGGGG - Intronic
1011837031 6:91444475-91444497 CAGCTGGGAATGCTAGCTATGGG + Intergenic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1014191591 6:118502346-118502368 CATATGGGTAATCTTGGCATGGG - Intronic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015689280 6:135903332-135903354 CAGCTGGTAAGGCTTGGTAAAGG + Intronic
1017297996 6:152821619-152821641 AAGCTGGGAAAGCATAGCAAGGG + Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1018401245 6:163422749-163422771 CAGCTGAGAAAGGTTGGCCCCGG + Intronic
1019573778 7:1726472-1726494 GAGCTGGGCCAGCTTGGCCTTGG - Intronic
1019745714 7:2699570-2699592 CTGCTAGGAAAGCTTGTAATTGG + Intronic
1020262119 7:6536470-6536492 CGGCTGGGAAAGGCGGGCATGGG + Intronic
1021621747 7:22556008-22556030 CAGCTGGGAAAGTTTAATATAGG - Intronic
1022477031 7:30717899-30717921 CAGCTAGGAAATCTTGGAATAGG + Intronic
1022666648 7:32416993-32417015 CGGCTGGGAGAGCCAGGCATGGG - Intergenic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1026736110 7:72949695-72949717 CAGTGGGGAAAGCTTAGCTTGGG + Exonic
1026786454 7:73304596-73304618 CAGTGGGGAAAGCTTAGCTTGGG + Intronic
1027107618 7:75415366-75415388 CAGTGGGGAAAGCTTAGCTTGGG - Intergenic
1029217573 7:98962401-98962423 GAGCTGGGAGGGATTGGCATTGG - Exonic
1033728430 7:144147188-144147210 CTGCTGGGATAGCCTGGCATTGG - Intergenic
1033831506 7:145259827-145259849 CAGCTGGGAAAGCTACACAAAGG - Intergenic
1034394216 7:150808017-150808039 CAGCTGGGGAAGCTTGAACTGGG + Intergenic
1035095900 7:156355179-156355201 CAGCATGGAAAGCATGCCATGGG - Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1045320411 8:101077916-101077938 CACCAGGGAAAGCTTGCCTTGGG - Intergenic
1045402567 8:101833916-101833938 CACCAGGGAAAGCTGAGCATTGG - Intronic
1045838757 8:106554691-106554713 CAGATGTGAAACCTGGGCATTGG + Intronic
1048375994 8:133822713-133822735 CAACTGGGAAGCCTTGGCTTGGG + Intergenic
1048554267 8:135458606-135458628 CAGCCTGCAAGGCTTGGCATGGG - Intronic
1048651487 8:136483492-136483514 CAGCTGGGAAAGAATGGAACTGG + Intergenic
1050264506 9:3875756-3875778 CAGCTGGGAAGGCAAGGGATGGG + Intronic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1052800051 9:32958273-32958295 CAGCTGGGGAAGCTTGAACTGGG + Intergenic
1053647473 9:40131693-40131715 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1053758255 9:41332150-41332172 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1054328455 9:63729647-63729669 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1054537106 9:66244477-66244499 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1057138756 9:92714158-92714180 GTGCTGGGAAAGCTTTGCATAGG - Exonic
1057759548 9:97861230-97861252 CGGCTGTGGAAGCGTGGCATGGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1061518643 9:131104273-131104295 CAGCCGGGAAAACTTGTCTTTGG + Intronic
1061780772 9:132994921-132994943 TGGCTGGGAAGGCTTGGCTTGGG + Intergenic
1202795258 9_KI270719v1_random:114990-115012 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1186347147 X:8705433-8705455 CGGCTGCAAAACCTTGGCATGGG - Intronic
1187236384 X:17471393-17471415 AAAATGGGAAAGCTTGGCAAAGG - Intronic
1187278492 X:17837451-17837473 CTAATGGGAAATCTTGGCATTGG + Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1192225772 X:69226857-69226879 CTGCTGGGTAGGCCTGGCATTGG - Intergenic
1192557644 X:72103169-72103191 CGCCTGGGAAAGCTTGGATTTGG + Intergenic
1195719177 X:107849555-107849577 CATCTGAGAAAGCTGGGCACAGG - Intronic
1199559357 X:149146753-149146775 CAGCGGGGAAGGCATGGCAAGGG + Intergenic
1199574830 X:149303748-149303770 GTGCTGGGAAAGGGTGGCATGGG + Intergenic
1199911817 X:152295350-152295372 CAGCTGGGGAAGCTTGAACTGGG - Intronic
1202050871 Y:20779270-20779292 GTGCAGGGAAAGCTTGTCATTGG + Intronic