ID: 1191220798

View in Genome Browser
Species Human (GRCh38)
Location X:57985935-57985957
Sequence CTATGCAGGTAGTCTGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 6, 2: 9, 3: 13, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191220794_1191220798 -2 Left 1191220794 X:57985914-57985936 CCATATGAAGACCACCAGTGGCT No data
Right 1191220798 X:57985935-57985957 CTATGCAGGTAGTCTGAGCTCGG 0: 1
1: 6
2: 9
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191220798 Original CRISPR CTATGCAGGTAGTCTGAGCT CGG Intergenic
900244156 1:1629966-1629988 CTATGGAGGGAGTGTGATCTGGG - Intronic
900428225 1:2590130-2590152 CTGAGCAGGTAGTCTGACCTGGG - Exonic
902534901 1:17113953-17113975 CTATGCAGGGACTGTGAGCCTGG + Intronic
903890863 1:26569534-26569556 CTATGGAGGTGGACTGTGCTGGG + Intronic
904280562 1:29415466-29415488 CTATGCAGCTGTTCTCAGCTTGG + Intergenic
906223665 1:44103495-44103517 CTATGCAGGTGCGCTGAGCTCGG - Intergenic
907162497 1:52381551-52381573 CTATGCTGGTGCTCTGAGGTTGG - Intronic
915123973 1:153650336-153650358 CTAGGTAGGAAGTCTGACCTAGG + Intergenic
915619845 1:157074506-157074528 CTATGCAGGTGGTCTGAGCTCGG + Intergenic
915650155 1:157303865-157303887 CTATGCACGTATTCTGAGAAAGG + Intergenic
916317133 1:163461710-163461732 CTTCACAGGTAGTCTGACCTTGG - Intergenic
917082970 1:171275157-171275179 AGATGGAGGTAGTCTAAGCTTGG - Intronic
920504166 1:206505076-206505098 CTATCCAGGAAATCTGGGCTGGG + Intergenic
921895021 1:220390841-220390863 CTATGCTGGAACTCTGACCTTGG + Intergenic
922585912 1:226735552-226735574 GTATGCAGGAAGGCTGAGTTGGG + Exonic
1072314815 10:94191527-94191549 CTATTCAGGGAGCCTGAGGTGGG + Intronic
1073061453 10:100736094-100736116 GTAAGCAGGGAGTGTGAGCTGGG + Intronic
1073282253 10:102363159-102363181 CCATGCAGGTCTTCTGGGCTTGG + Intronic
1073511122 10:104043174-104043196 CTCTGGAGGTAGACTGATCTGGG + Intronic
1076709093 10:132321304-132321326 CTCTGCAGGTGGGCTGGGCTTGG - Intronic
1077730294 11:4722910-4722932 CTATGCAGGTGGTCTAAGCTCGG - Intronic
1078239202 11:9514831-9514853 CTATGTAAGAAGTCTGGGCTGGG + Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079302381 11:19289696-19289718 TTTTGCAGTCAGTCTGAGCTGGG - Intergenic
1085201116 11:74702856-74702878 CGACGCAGGTTGTCTGGGCTTGG + Exonic
1087399303 11:97644479-97644501 TTATGCCTGTAGTCTCAGCTTGG + Intergenic
1088619880 11:111671129-111671151 CTACTCAGGTGGGCTGAGCTGGG - Intronic
1088843168 11:113643660-113643682 CTGTTCAAGGAGTCTGAGCTCGG + Intergenic
1089662383 11:119993948-119993970 CAAGGCAGGTGTTCTGAGCTTGG + Intergenic
1096065661 12:48737932-48737954 CTACTCAGGGAGGCTGAGCTGGG - Intergenic
1096626210 12:52897604-52897626 CTCACCAGGTGGTCTGAGCTCGG - Exonic
1097330288 12:58325471-58325493 CTGTGCAGATAGCTTGAGCTAGG + Intergenic
1097615602 12:61880576-61880598 CTACGCAGGAGGGCTGAGCTCGG + Intronic
1098264738 12:68706876-68706898 CTATTCAGGTGGTCTGAGCTCGG + Intronic
1099195539 12:79610242-79610264 CTATGCAGCTTGGTTGAGCTGGG + Intronic
1101985502 12:109442944-109442966 CAACGCAGGTAGGCAGAGCTAGG + Intronic
1102617524 12:114167594-114167616 CACTGCAGGGAGACTGAGCTTGG + Intergenic
1106542683 13:30704071-30704093 AAATGCAGGAAGTCTTAGCTGGG - Intergenic
1115951658 14:38728285-38728307 CTATGCAGGTGGGCTGAGCTCGG + Intergenic
1122097373 14:99381597-99381619 CTCTGCAGGAAGGCTGACCTGGG + Intergenic
1124783390 15:32656979-32657001 CCATGCAGCTGGTCTGAGCTAGG - Intronic
1125734477 15:41914297-41914319 CTATGCAGGTTTCCAGAGCTGGG - Intronic
1125840998 15:42801139-42801161 CTATGCAGGTGGTCAGAGCTTGG - Intronic
1126467357 15:48973165-48973187 CTATGCAGGTGCGCTGAGCTCGG + Intergenic
1127499461 15:59543077-59543099 TGATGCAGGTGGTCTGGGCTGGG + Intergenic
1129617165 15:77107742-77107764 CTATTCAGGTAATATGAGCGGGG - Exonic
1131111639 15:89768160-89768182 GTGTGCAGGTGGCCTGAGCTTGG + Intronic
1131632813 15:94196990-94197012 CTTTGCAGGTCGGCTGTGCTGGG + Intergenic
1133379163 16:5315514-5315536 CTCTGCAGGTGTTTTGAGCTGGG + Intergenic
1133932618 16:10244536-10244558 CTACGCAGGCATCCTGAGCTAGG + Intergenic
1135747130 16:25026803-25026825 ACATGCATGTAGTCTCAGCTAGG + Intergenic
1138750448 16:59413323-59413345 CTATGAAAGTAGTCTCGGCTGGG - Intergenic
1139191480 16:64868300-64868322 ATCTGCAGGTAGTTTGTGCTTGG + Intergenic
1140753678 16:78048626-78048648 CTATGTAAGTGGTCTGAGCTCGG - Intronic
1141534300 16:84668503-84668525 CTCTGCAGGTTGACTGGGCTTGG + Intergenic
1142523251 17:519601-519623 CTGTGCAGGTGGTCTCAGCGGGG + Intronic
1142789360 17:2251755-2251777 CCAGCCAGGTACTCTGAGCTCGG - Intronic
1143276933 17:5718611-5718633 CTATGCATGGAGGCTGAGCCTGG + Intergenic
1143509243 17:7386454-7386476 CTCTGTATGTAGTCTGTGCTGGG - Intronic
1143994019 17:10991255-10991277 TGATGCAGGTGGTCTGGGCTGGG + Intergenic
1145751595 17:27358868-27358890 ACATGCCTGTAGTCTGAGCTGGG - Intergenic
1146572614 17:33965939-33965961 ATAGGCAAGTGGTCTGAGCTGGG - Intronic
1149214514 17:54338297-54338319 CAATGCAGAAAGTTTGAGCTGGG - Intergenic
1150359228 17:64516042-64516064 TTATGCATTTACTCTGAGCTAGG - Intronic
1150458587 17:65328147-65328169 TTAGGCAGGGAATCTGAGCTAGG + Intergenic
1151298425 17:73203124-73203146 CTGTGCAGGGAGTCGGATCTTGG - Exonic
1151627494 17:75286321-75286343 CTATGGAGAGAATCTGAGCTGGG + Exonic
1203190317 17_KI270729v1_random:178060-178082 CTCTGCAGATGGTCTGAGATGGG - Intergenic
1157674429 18:49558546-49558568 CTATGCTGGTACCCTGATCTTGG + Intergenic
1158518937 18:58154233-58154255 CTCTGCAGGATGCCTGAGCTCGG - Intronic
1158978559 18:62736257-62736279 TTATGCAGTAAGTCTGAGGTGGG - Intronic
1159569098 18:70091560-70091582 CTATGCCGGCACTCTGATCTTGG + Intronic
1160759370 19:775318-775340 CCATGCTGGTGGCCTGAGCTGGG + Intergenic
1162481723 19:10930885-10930907 CTATTCAGGAAGGCTGAGATGGG + Intronic
1162858517 19:13488216-13488238 CTAAGCAGGTAGACTGAAGTTGG - Intronic
1165146890 19:33736522-33736544 CTATGCATCTTGTCTGAGCTTGG - Intronic
925824514 2:7834180-7834202 CTATGCTGGCACTCTGATCTTGG + Intergenic
926644573 2:15275138-15275160 GAATGCAGGTAATCTGGGCTGGG + Intronic
933878052 2:86638883-86638905 CTTTGCATGTGGTGTGAGCTTGG + Intronic
934713648 2:96530998-96531020 CCTTGCAGGTAGTATGACCTGGG - Intergenic
935459230 2:103309328-103309350 CATTGCAGGTTGTCTGTGCTGGG - Intergenic
935934815 2:108170426-108170448 CTGCCCAGGTGGTCTGAGCTGGG - Intergenic
938263924 2:129913008-129913030 CCATGCAGGAAATCTGAGCATGG + Intergenic
940783083 2:157953860-157953882 CTATACATGTAGTCTGATATAGG + Intronic
941268629 2:163396731-163396753 CTATTCATGTTGTCTGAGATTGG - Intergenic
942190701 2:173466297-173466319 ATATGCATGAAGTCTAAGCTAGG - Intergenic
942558683 2:177198355-177198377 CTATGCAGGTGGTCTGAGCTCGG + Intergenic
942613887 2:177769774-177769796 CTATTCAGGGAGGCTGAGATGGG + Intronic
943064400 2:183071216-183071238 CTATGCAGGTGGTCTGAGCTCGG - Intergenic
943115864 2:183669425-183669447 CCTTCCAGGTAGTATGAGCTTGG + Intergenic
944763410 2:202840507-202840529 CTATGCAGGTGGTCTGAGCTCGG - Intronic
946879177 2:224160369-224160391 CCATACAGGCAGACTGAGCTTGG + Intergenic
1169799802 20:9503243-9503265 CCATGCTGGTACCCTGAGCTTGG + Intergenic
1170048600 20:12114296-12114318 ATATGCAGGGAGTGTGAACTGGG + Intergenic
1171389141 20:24790034-24790056 CCCTGCAGGGAGGCTGAGCTTGG + Intergenic
1172993961 20:39056210-39056232 CGATACAGGGAGTCTGAACTGGG + Intergenic
1173205951 20:40993329-40993351 GTAGGCAGATTGTCTGAGCTTGG - Intergenic
1174682595 20:52423269-52423291 CTATACAGGAAGTCTGATCTTGG - Intergenic
1175226038 20:57444587-57444609 CACTGCAGGTAGACTCAGCTTGG + Intergenic
1177482668 21:21711811-21711833 CTTTGCAGCTAGTCAGAACTTGG - Intergenic
1181036953 22:20174330-20174352 CTGTGCAGGGAGTCTGATCAGGG + Intergenic
1184699673 22:46162212-46162234 CCTGGCAGGTAGTGTGAGCTTGG + Intronic
953445436 3:42960898-42960920 CTGTGCATGGAGTCTGAGCAGGG - Intronic
959955391 3:112232301-112232323 TTATGCAGGTGGTCTGAGCAGGG - Intronic
962265872 3:133943936-133943958 CTGTGCAGTTAGTGTAAGCTAGG - Intronic
962627309 3:137238766-137238788 CTATGCTGGCACTCTGACCTTGG + Intergenic
962712781 3:138101657-138101679 CTATGCAGGTGGTCTGAGCTCGG - Intronic
964615052 3:158654854-158654876 CTATACAGGTAGTATGATTTAGG - Intronic
964802276 3:160569048-160569070 CTATGCAGGTGATCTGAGCTCGG + Intergenic
965176965 3:165347211-165347233 CTATGCAAGTGCTCTTAGCTGGG - Intergenic
971568500 4:28177978-28178000 CTATGCAGATATGCTGATCTTGG + Intergenic
975582858 4:75922264-75922286 CTATGCAGGGAGGCTGAGGTGGG + Intronic
977928636 4:102728898-102728920 TTATGCAGGTGATCTGAGCTCGG - Intronic
979819942 4:125158558-125158580 CTTTGCAGGTGGTCTTGGCTAGG + Intergenic
979824698 4:125218536-125218558 CTAAGCAAGAAGCCTGAGCTGGG + Intergenic
980903197 4:138924498-138924520 CTATGCAGGTGGGTTGAGATGGG + Intergenic
985420561 4:189781223-189781245 CCATTCAGGTTATCTGAGCTAGG + Intergenic
987142686 5:14961538-14961560 CTATGCAGGTAGTCTTCTTTGGG - Intergenic
988613565 5:32751508-32751530 CTAACCAGGTATTCTGAGCAGGG + Intronic
988781960 5:34530446-34530468 CTATTCAGGGAGTCTGAGGTGGG - Intergenic
989219589 5:38942017-38942039 CTATGTAGGTATTCAGTGCTTGG + Exonic
992181938 5:74205953-74205975 CCATGCTGGTACTCTGATCTTGG + Intergenic
996432874 5:123401068-123401090 CTATGCAAGTGGTCTGAGCTCGG - Intronic
998476253 5:142424555-142424577 CTAGGCAGGGAGTCTGAGAGGGG - Intergenic
998887147 5:146706377-146706399 CTATGCAGGTGGTGTGAGCTTGG - Intronic
1000040928 5:157484727-157484749 CTTGGCAGCTATTCTGAGCTGGG - Intronic
1003566051 6:7223143-7223165 CTATGAAGGGAGGCTGAGGTGGG + Intronic
1003787407 6:9501933-9501955 CGTTGCAGGTAGTTTGAGGTGGG - Intergenic
1003819113 6:9876187-9876209 CCATGCAGGTACCCTGATCTTGG + Intronic
1005931271 6:30486182-30486204 CTATGATGGTACTCTGGGCTTGG - Intergenic
1006637957 6:35474003-35474025 CTAGGCAGGTAGATTGAGGTGGG + Exonic
1012297930 6:97547766-97547788 CCATGCTGGTACTCTGATCTTGG - Intergenic
1018317295 6:162569530-162569552 CTATGCAGATGGTCTGAGCTTGG + Intronic
1022921470 7:35020019-35020041 CTACTCAGGAAGGCTGAGCTGGG + Intronic
1030543781 7:110867171-110867193 CCATGCAGGCACTCTGATCTTGG - Intronic
1032379253 7:131459132-131459154 TAATGCAGGTAGACTGAGGTGGG + Intronic
1038325700 8:26571268-26571290 CTGTTCAGGATGTCTGAGCTGGG + Intronic
1040662915 8:49596468-49596490 CTATGCATGTAGTAAGAGATGGG - Intergenic
1041781178 8:61579473-61579495 CTATGCAGGTGGTCTGAGCTCGG + Intronic
1042694195 8:71538730-71538752 CTATCCAGGTAGGCTAATCTAGG + Intronic
1043560846 8:81491516-81491538 CTATTCAGGGAGGCTGAGATGGG - Intergenic
1045414240 8:101950811-101950833 GACTGCAGGTCGTCTGAGCTTGG - Intronic
1047666812 8:127100710-127100732 CAATGTGGGTAGTCTGAACTGGG + Intergenic
1049096977 8:140554316-140554338 CTCTGAAGGGAGTCTGAGCAGGG - Intronic
1049743106 8:144250370-144250392 CTAAGCCTGGAGTCTGAGCTGGG - Intronic
1050570099 9:6928849-6928871 CTATGGAAGTAGTGTGAGCAGGG + Intronic
1055640743 9:78316949-78316971 CTATGCAGGTAATATGGGCAAGG + Intronic
1056438561 9:86597309-86597331 CCATGCTGGTGCTCTGAGCTTGG - Intergenic
1057943693 9:99306413-99306435 CTATGCAGGTGGGCTGAGCTCGG + Intergenic
1059098837 9:111449890-111449912 CTGTGCAGGTGTTCTGAGCTGGG - Intronic
1059800154 9:117742021-117742043 CTAGGCAGGTTGTGTGACCTTGG + Intergenic
1060284018 9:122233014-122233036 CTAGGAAGGTAATGTGAGCTGGG + Intergenic
1062480490 9:136748655-136748677 CTGTGCAGCTGGTCTGATCTGGG - Intergenic
1187642258 X:21306511-21306533 CCATGCAGGTAGTATGAATTTGG - Intergenic
1191220798 X:57985935-57985957 CTATGCAGGTAGTCTGAGCTCGG + Intergenic
1192377067 X:70573639-70573661 CTTTGCAGGCAGTCTTTGCTTGG - Intronic
1192555419 X:72085195-72085217 CTATGAAGGCAGGCTGTGCTGGG - Intergenic
1192555659 X:72087011-72087033 CTATGAAGGAAGGCTGGGCTGGG + Intergenic
1198619169 X:138487831-138487853 CTACTCAGGTGGGCTGAGCTTGG - Intergenic
1198663213 X:138994172-138994194 CTATGCTGGTACCTTGAGCTTGG - Intronic
1199298542 X:146186497-146186519 CTATGCAGGTACTCACTGCTGGG - Intergenic
1199922713 X:152426209-152426231 ATATGCAGTTATTCTGATCTGGG - Intronic
1199927304 X:152480826-152480848 TTTTGCAGGTGGTCTGAGCTCGG + Intergenic
1200691947 Y:6314717-6314739 CAATGCTGACAGTCTGAGCTTGG + Intergenic
1200832476 Y:7700435-7700457 CAATGCTGACAGTCTGAGCTTGG + Intergenic
1201043325 Y:9860006-9860028 CAATGCTGACAGTCTGAGCTTGG - Intergenic