ID: 1191224688

View in Genome Browser
Species Human (GRCh38)
Location X:58030993-58031015
Sequence TGGAATTGTTCAGCTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191224682_1191224688 8 Left 1191224682 X:58030962-58030984 CCACCTCAGGGAAATGTAAAGCC No data
Right 1191224688 X:58030993-58031015 TGGAATTGTTCAGCTGGTGGTGG No data
1191224683_1191224688 5 Left 1191224683 X:58030965-58030987 CCTCAGGGAAATGTAAAGCCACT No data
Right 1191224688 X:58030993-58031015 TGGAATTGTTCAGCTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191224688 Original CRISPR TGGAATTGTTCAGCTGGTGG TGG Intergenic
No off target data available for this crispr