ID: 1191226376

View in Genome Browser
Species Human (GRCh38)
Location X:58048759-58048781
Sequence GAGAAAGGTGGGAAGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191226376_1191226380 3 Left 1191226376 X:58048759-58048781 CCATCAGTCTTCCCACCTTTCTC No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226376_1191226383 14 Left 1191226376 X:58048759-58048781 CCATCAGTCTTCCCACCTTTCTC No data
Right 1191226383 X:58048796-58048818 CACTGCCTGAGGCAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191226376 Original CRISPR GAGAAAGGTGGGAAGACTGA TGG (reversed) Intergenic
No off target data available for this crispr