ID: 1191226380

View in Genome Browser
Species Human (GRCh38)
Location X:58048785-58048807
Sequence GATTAGCCCTGCACTGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191226369_1191226380 23 Left 1191226369 X:58048739-58048761 CCCCCCTCCCACTCACACTGCCA No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226372_1191226380 20 Left 1191226372 X:58048742-58048764 CCCTCCCACTCACACTGCCATCA No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226377_1191226380 -8 Left 1191226377 X:58048770-58048792 CCCACCTTTCTCTGAGATTAGCC No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226371_1191226380 21 Left 1191226371 X:58048741-58048763 CCCCTCCCACTCACACTGCCATC No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226374_1191226380 16 Left 1191226374 X:58048746-58048768 CCCACTCACACTGCCATCAGTCT No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226370_1191226380 22 Left 1191226370 X:58048740-58048762 CCCCCTCCCACTCACACTGCCAT No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226378_1191226380 -9 Left 1191226378 X:58048771-58048793 CCACCTTTCTCTGAGATTAGCCC No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226373_1191226380 19 Left 1191226373 X:58048743-58048765 CCTCCCACTCACACTGCCATCAG No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226375_1191226380 15 Left 1191226375 X:58048747-58048769 CCACTCACACTGCCATCAGTCTT 0: 2
1: 0
2: 6
3: 17
4: 239
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data
1191226376_1191226380 3 Left 1191226376 X:58048759-58048781 CCATCAGTCTTCCCACCTTTCTC No data
Right 1191226380 X:58048785-58048807 GATTAGCCCTGCACTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191226380 Original CRISPR GATTAGCCCTGCACTGCCTG AGG Intergenic
No off target data available for this crispr